View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0740_low_178 (Length: 206)
Name: NF0740_low_178
Description: NF0740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0740_low_178 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 118; Significance: 2e-60; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 1 - 126
Target Start/End: Original strand, 1841273 - 1841398
Alignment:
Q |
1 |
gaaagtgcaatgaatttctcagacaactcctgtcttcgttttctctctgccattatatgatcaatacactgtgaactgcttctacctctcttcactctat |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
T |
1841273 |
gaaagtgcaatgaatttctcagacaactcctgtcttcgttttctctctgccattatatgatcaatacactgtgaactgcttctacctctcttcactccat |
1841372 |
T |
 |
Q |
101 |
tttgttgatttattttcatctcactc |
126 |
Q |
|
|
||||||||||||||||||| |||||| |
|
|
T |
1841373 |
tttgttgatttattttcatttcactc |
1841398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 1 - 97
Target Start/End: Original strand, 1823952 - 1824048
Alignment:
Q |
1 |
gaaagtgcaatgaatttctcagacaactcctgtcttcgttttctctctgccattatatgatcaatacactgtgaactgcttctacctctcttcactc |
97 |
Q |
|
|
||||||||||||||||| |||||||| || ||||| | |||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||| |
|
|
T |
1823952 |
gaaagtgcaatgaatttttcagacaattcttgtctcctttttctctctgccattatatgatcaatacattgtgaactgcttctacctttcttcactc |
1824048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3466 times since January 2019
Visitors: 4814