View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0740_low_180 (Length: 205)
Name: NF0740_low_180
Description: NF0740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0740_low_180 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 40; Significance: 0.00000000000007; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 1 - 40
Target Start/End: Original strand, 23919643 - 23919682
Alignment:
Q |
1 |
accttcatttactattctgaccccaaacattggtcgaacc |
40 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
T |
23919643 |
accttcatttactattctgaccccaaacattggtcgaacc |
23919682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University