View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0740_low_180 (Length: 205)

Name: NF0740_low_180
Description: NF0740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0740_low_180
NF0740_low_180
[»] chr7 (1 HSPs)
chr7 (1-40)||(23919643-23919682)


Alignment Details
Target: chr7 (Bit Score: 40; Significance: 0.00000000000007; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 1 - 40
Target Start/End: Original strand, 23919643 - 23919682
Alignment:
1 accttcatttactattctgaccccaaacattggtcgaacc 40  Q
    ||||||||||||||||||||||||||||||||||||||||    
23919643 accttcatttactattctgaccccaaacattggtcgaacc 23919682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University