View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0740_low_42 (Length: 416)
Name: NF0740_low_42
Description: NF0740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0740_low_42 |
 |  |
|
[»] scaffold0989 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr2 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 30 - 312
Target Start/End: Original strand, 12765716 - 12765998
Alignment:
Q |
30 |
ggataaagatgagttcaagaaaatttcaaattcaatatgcattaagaaggtataggagaggtttcaaaactcttgtaaaggagagggcaaagtaaagaag |
129 |
Q |
|
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
12765716 |
ggataaagatgagttcaagaaaatttcaaattcaaaatgcattaagaaggtataggagaggtttcaaaactcttgtaaaggagagggcaaagtaaagaag |
12765815 |
T |
 |
Q |
130 |
ttgtttttcgaaactctaaggtgagttcaaatctttgcatatgaaagagtcataaatgatttctgaacatttatctagagttatcgctatttcaaattaa |
229 |
Q |
|
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
12765816 |
ttgtttttcgaaactctaaggtgagttcaaatcattgcatatgaaagagtcataaatgatttctgaacatttatctagagttatcgctatttcaaattaa |
12765915 |
T |
 |
Q |
230 |
ttaaaatatattttgagaagctagaagatgtaagaattatggagaagatactctactaattagatctcaaattcgagcatatt |
312 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
12765916 |
ttaaaatatattttgagaagctagaagatgtaagaattatggagaagatactctactaattagatctcaaattcgagcatatt |
12765998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0989 (Bit Score: 36; Significance: 0.00000000004; HSPs: 1)
Name: scaffold0989
Description:
Target: scaffold0989; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 198 - 312
Target Start/End: Complemental strand, 649 - 534
Alignment:
Q |
198 |
atttatctagagttatcgctatttcaaattaattaaaat-atattttgagaagctagaagatgtaagaattatggagaagatactctactaattagatct |
296 |
Q |
|
|
|||| |||||||||||| |||| |||||| |||||||| | | ||| ||| |||||||||| ||||||||||||||||||||| | |||||| | |
|
|
T |
649 |
atttttctagagttatctctatctcaaatcaattaaaaagaaacagtgaaaagttagaagatgtgagaattatggagaagatactccgatcattagaccc |
550 |
T |
 |
Q |
297 |
caaattcgagcatatt |
312 |
Q |
|
|
|||||||||||||||| |
|
|
T |
549 |
caaattcgagcatatt |
534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University