View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0740_low_48 (Length: 405)
Name: NF0740_low_48
Description: NF0740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0740_low_48 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 62; Significance: 1e-26; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 29 - 94
Target Start/End: Complemental strand, 23993617 - 23993552
Alignment:
| Q |
29 |
agctaggttgcagagaaaagctgaggtaatgtttatggtgttgagagttactgacttgaaagctta |
94 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23993617 |
agctaagttgcagagaaaagctgaggtaatgtttatggtgttgagagttactgacttgaaagctta |
23993552 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 58; Significance: 3e-24; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 29 - 94
Target Start/End: Original strand, 25661494 - 25661559
Alignment:
| Q |
29 |
agctaggttgcagagaaaagctgaggtaatgtttatggtgttgagagttactgacttgaaagctta |
94 |
Q |
| |
|
||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
25661494 |
agctaagttgcagagaaaagctgaggtaacgtttatggtgttgagagttactgacttgaaagctta |
25661559 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 54; Significance: 7e-22; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 29 - 94
Target Start/End: Complemental strand, 7769630 - 7769565
Alignment:
| Q |
29 |
agctaggttgcagagaaaagctgaggtaatgtttatggtgttgagagttactgacttgaaagctta |
94 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
7769630 |
agctaagttgcagagaaaagttgaggtaatgtttatggtgttgagagttactgacttgaaggctta |
7769565 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3610 times since January 2019
Visitors: 4816