View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0740_low_54 (Length: 391)
Name: NF0740_low_54
Description: NF0740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0740_low_54 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 281; Significance: 1e-157; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 16 - 308
Target Start/End: Original strand, 47059517 - 47059809
Alignment:
| Q |
16 |
atagaacaactcgaacaaaagaaggacaatgctgaaatatttaatgtggattactatactttgatggggttgccacatgggtgtgatcaatctgaattgg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47059517 |
atagaacaactcgaacaaaagaaggacaatgctgaaatatttaatgtggattactatactttgatggggttgccacatgggtgtgatcaatctgaattgg |
47059616 |
T |
|
| Q |
116 |
agagggcctatcgtttgcttgatttgaggcataatccagagattgccacatgtttcatcgaacggtgtgaacttgatgaaaatcagaatattcagttaat |
215 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47059617 |
agagggcctatcttttgcttgatttgaggcataattcagagattgccacatgtttcatcgaacggtgtgaacttgatgaaaatcagaatattcagttaat |
47059716 |
T |
|
| Q |
216 |
taaggatagagcgaggatgtttgctgatttgttgtataaattgattgagaaagggcattcaagtgttaggaatacaattatggaagaagaatc |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47059717 |
taaggatagagcgaggatgtttgctgatttgttgtataaattgattgaaaaagggcattcaagtgttaggaatacaattatggaagaagaatc |
47059809 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 48; Significance: 2e-18; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 42 - 149
Target Start/End: Original strand, 11726195 - 11726302
Alignment:
| Q |
42 |
caatgctgaaatatttaatgtggattactatactttgatggggttgccacatgggtgtgatcaatctgaattggagagggcctatcgtttgcttgatttg |
141 |
Q |
| |
|
|||||||||||| ||||| ||||||||| || |||||| ||||| ||||||||||||| || ||| |||||||||||| | || ||||||||||||| |
|
|
| T |
11726195 |
caatgctgaaatgtttaacgtggattaccatgttttgattgggtttccacatgggtgtgttcgatcagaattggagaggacgtactatttgcttgatttg |
11726294 |
T |
|
| Q |
142 |
aggcataa |
149 |
Q |
| |
|
|||||||| |
|
|
| T |
11726295 |
aggcataa |
11726302 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 32 - 119
Target Start/End: Complemental strand, 11726885 - 11726797
Alignment:
| Q |
32 |
aaaagaaggacaatgctgaaatatttaatgtgga-ttactatactttgatggggttgccacatgggtgtgatcaatctgaattggagag |
119 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||||| ||||||| ||||||||||||| ||| ||| ||||||| ||| ||||||||||| |
|
|
| T |
11726885 |
aaaagaagaacaatgctgaaatgtttaatgtggatttactatgctttgatggggtttccatatgaatgtgatcgatcagaattggagag |
11726797 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 240 - 305
Target Start/End: Complemental strand, 11726671 - 11726607
Alignment:
| Q |
240 |
tgatttgttgtataaattgattgagaaagggcattcaagtgttaggaatacaattatggaagaaga |
305 |
Q |
| |
|
|||||| ||||| |||||| ||||||||||| ||||| |||||| |||||| |||||||||||||| |
|
|
| T |
11726671 |
tgattttttgtagaaattgcttgagaaagggtattcatgtgttatgaatac-attatggaagaaga |
11726607 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3727 times since January 2019
Visitors: 4818