View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0740_low_56 (Length: 390)
Name: NF0740_low_56
Description: NF0740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0740_low_56 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 285; Significance: 1e-160; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 285; E-Value: 1e-160
Query Start/End: Original strand, 92 - 380
Target Start/End: Complemental strand, 6516300 - 6516012
Alignment:
Q |
92 |
ggtcagcatttttagttcataattaaaaaggtcatatattttataattattgaacaaatatagttacctcttgttgaaattgcctctctccatgagctaa |
191 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6516300 |
ggtcagcatttttagttcataattaaaaaggtcatatattttataattattgaacaaatatagttacctcttgttgaaattgcctctctccatgagctaa |
6516201 |
T |
 |
Q |
192 |
atcaggtttaagaacttttatagcaacaatagtgtgatcaagcacacctttaaaaacaggtccataccccccttcaccaattttgagagcattgtcaaag |
291 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6516200 |
atcaggtttaagaacttttatagcaacaatagtgtgatcaagcacacctttaaaaacaggtccataccccccttcaccaattttgagagcattgtcaaag |
6516101 |
T |
 |
Q |
292 |
ccattagttgcaacttgaatttctttaatatcatatcttctatatggaatgctattatacacaacttcttgcaatgttcttctcctttg |
380 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
T |
6516100 |
ccattagttgcaacttgaatttctttaatatcatatcttctatatggaatgctattatacacaacttcttgcaatgttcttatcctttg |
6516012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 229 - 322
Target Start/End: Complemental strand, 42673549 - 42673456
Alignment:
Q |
229 |
tcaagcacacctttaaaaacaggtccataccccccttcaccaattttgagagcattgtcaaagccattagttgcaacttgaatttctttaatat |
322 |
Q |
|
|
||||| || ||||| |||||||||||||| || ||||||||||||||| | | | |||||| ||| |||||||||| |||||||| ||||| |
|
|
T |
42673549 |
tcaagtactcctttgaaaacaggtccatatccaccttcaccaattttgccatccatatcaaagtaatttgttgcaacttcaatttcttcaatat |
42673456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University