View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0740_low_61 (Length: 380)
Name: NF0740_low_61
Description: NF0740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0740_low_61 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 290; Significance: 1e-163; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 290; E-Value: 1e-163
Query Start/End: Original strand, 29 - 368
Target Start/End: Complemental strand, 42334995 - 42334656
Alignment:
| Q |
29 |
ataaaggaactttaggatcatctgattaggtaagtatgcgaacatatcaacaatttgtcagcaaatatacttgcttccaaagtgctgcgtagatgtgaat |
128 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42334995 |
ataaaggaactttaggattatctgattaggtaagtatgcgaacatatcaacaatttgtcagcaaatatacttgcttccaaagtgctgcgtagatgtgaat |
42334896 |
T |
|
| Q |
129 |
gtgacttggacccaattcatatctttatgtttatggtgaccttgaacccctaaaagacaaacacttccttttggaannnnnnnnnnnnnnggtagagcat |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||| |
|
|
| T |
42334895 |
gtgacttggacccaattcatatctttatgtttatggtgaccttgaacccctaaaagacaaacacttccttttggaactatatatttttttggtacagcat |
42334796 |
T |
|
| Q |
229 |
ccttttgaagctaatcttatacattttccttatatagcataaacaatcgataaaagaataaacgtgaccatttgaccctttcctgttgccacatatatta |
328 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42334795 |
ccttttgaagctaatcttatacattttccttatatagcataaacaatcgataaaagaataaacgtgaccatttgaccctttcctgttgccacatatatta |
42334696 |
T |
|
| Q |
329 |
tatctcataccttcttatcaaaatctcatcgtatcagaat |
368 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42334695 |
tatctcataccttcttatcaaaatctcatcgtatcagaat |
42334656 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3021 times since January 2019
Visitors: 4805