View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0740_low_77 (Length: 355)

Name: NF0740_low_77
Description: NF0740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0740_low_77
NF0740_low_77
[»] chr5 (1 HSPs)
chr5 (61-333)||(14582286-14582558)


Alignment Details
Target: chr5 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 61 - 333
Target Start/End: Complemental strand, 14582558 - 14582286
Alignment:
61 actcagaaaaaagcataatccctttgtgatatgagaagccaaaagctaaagcacaaagcaaactgtttaggaaaatggagggagagtgtgtagggttttt 160  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14582558 actcagaaaaaagcataatccctttgtgatatgagaagccaaaagctaaagcacaaagcaaactgtttaggaaaatggagggagagtgtgtagggttttt 14582459  T
161 gtttaataccctctcacacttctctccatgtttgttttaagaaccatggattgatttttgccaacaaagaagcttcatccttattacaaacaagattcaa 260  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14582458 gtttaataccctctcacacttctctccatgtttgttttaagaaccatggattgatttttgccaacaaagaagcttcatccttattacaaacaagattcaa 14582359  T
261 gtcttgatggattggtttagaggatgcttaaagggctccacatagaaaggtagtggggaagttggtgtctctg 333  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14582358 gtcttgatggattggtttagaggatgcttaaagggctccacatagaaaggtagtggggaagttggtgtctctg 14582286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 4459 times since January 2019
Visitors: 4835