View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0740_low_81 (Length: 352)
Name: NF0740_low_81
Description: NF0740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0740_low_81 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 94 - 343
Target Start/End: Complemental strand, 31781347 - 31781098
Alignment:
| Q |
94 |
gtttgtgcgtgtccgcggcgttttgcgacggctactgcgtcgtttaaggcttggattgcttctggtgttaagcattgtcttgctgatgataccggtgtcg |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||| | |
|
|
| T |
31781347 |
gtttgtgcgtgtccgcggcgttttgcgacggctactgcgtcgtttaaagcttggattgcttctggtgttaagcattgtcttgctgatgatactggtgttg |
31781248 |
T |
|
| Q |
194 |
gcatggtttgaagtttgtattcataaaacgatggaataacagaaaataattttgatattaatgatggaagaaggtgaggtttataaattagaaaagtggt |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31781247 |
gcatggtttgaagtttgtattcataaaacgatggaataacagaaaataattttgatattaatgatggaagaaggtgaggtttataaattagaaaagtggt |
31781148 |
T |
|
| Q |
294 |
tttatgttgtgaagtgagagtaatactgagt--gagtaagtagtagtataat |
343 |
Q |
| |
|
||||||||||||||| ||||| |||||||| ||||||||||||||||||| |
|
|
| T |
31781147 |
tttatgttgtgaagt--gagtactactgagtgagagtaagtagtagtataat |
31781098 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4334 times since January 2019
Visitors: 4832