View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0740_low_93 (Length: 327)
Name: NF0740_low_93
Description: NF0740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0740_low_93 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 168; Significance: 5e-90; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 168; E-Value: 5e-90
Query Start/End: Original strand, 14 - 231
Target Start/End: Complemental strand, 4670102 - 4669875
Alignment:
| Q |
14 |
atatggtcggtaaattagagcttccaaaccaaaatcatccatatctatgcaaattacaatgacttaacaaagttagtgaagtgaaa---------tgttc |
104 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
4670102 |
atatggtcgataaattagagcttccaaaccaaaatcatccatatctatgcaaattacaatgacttaacaaagttagtgaagtgaaagtcactaaatgttg |
4670003 |
T |
|
| Q |
105 |
tctagtgagcttttcgactggtccaaaatatcaagatgcatatg-atgccattcctatctatgcatgacaccttgtactttgaagacttagacaatataa |
203 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4670002 |
tctagtgagcttttcgactagtccaaaatatcaagatacatatggatgccattcctatcgatgcatgacaccttgtactttgaagacttagacaatataa |
4669903 |
T |
|
| Q |
204 |
ttgttgtgccttgtatgacggttatgcc |
231 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
4669902 |
ttgttgtgccttgtatgacggttatgcc |
4669875 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5210 times since January 2019
Visitors: 4845