View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0740_low_96 (Length: 324)
Name: NF0740_low_96
Description: NF0740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0740_low_96 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 37 - 246
Target Start/End: Complemental strand, 46449422 - 46449213
Alignment:
| Q |
37 |
tgaacagccacttaagttaaaatgtattagaaatacttattcaaatatcactgctactcacttcttgtaagaagtctgctacattttttctctcaggaca |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46449422 |
tgaacagccacttaagttaaaatgtattagaaatacttattcaaatatcactgctactcacttcttgtaagaagtctgctacattttttctctcaggaca |
46449323 |
T |
|
| Q |
137 |
actgaatcccataagtttgaaaaattcaatagcagcctcacgcggcccctgatatacaatctgaccctcggacaacagaatgacatcatcaaacaattca |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46449322 |
actgaatcccataagtttgaaaaattcaatagcagcctcacgcggcccctgatatacaatctgaccctcggacaacagaatgacatcatcaaacaattca |
46449223 |
T |
|
| Q |
237 |
taggtctctg |
246 |
Q |
| |
|
|||||||||| |
|
|
| T |
46449222 |
taggtctctg |
46449213 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4754 times since January 2019
Visitors: 4839