View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0740_low_99 (Length: 315)

Name: NF0740_low_99
Description: NF0740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0740_low_99
NF0740_low_99
[»] chr1 (1 HSPs)
chr1 (53-188)||(45649572-45649707)


Alignment Details
Target: chr1 (Bit Score: 124; Significance: 9e-64; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 124; E-Value: 9e-64
Query Start/End: Original strand, 53 - 188
Target Start/End: Original strand, 45649572 - 45649707
Alignment:
53 ttttttagcgtgtctttccatcgattataaggcttgtttgttggtctagtgttccttgtttgattgtctttgttataagttgtgaatttgactctcagac 152  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||    
45649572 ttttttagtgtgtctttccatcgattataaggcttgtttgttggtctagtgtttcttgtttgattatctttgttataagttgtgaatttgactctcagac 45649671  T
153 cgccttctctatctcattttctccctccctccctcc 188  Q
    ||||||||||||||||||||||||||||||||||||    
45649672 cgccttctctatctcattttctccctccctccctcc 45649707  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 4642 times since January 2019
Visitors: 4838