View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0740_low_99 (Length: 315)
Name: NF0740_low_99
Description: NF0740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0740_low_99 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 124; Significance: 9e-64; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 124; E-Value: 9e-64
Query Start/End: Original strand, 53 - 188
Target Start/End: Original strand, 45649572 - 45649707
Alignment:
Q |
53 |
ttttttagcgtgtctttccatcgattataaggcttgtttgttggtctagtgttccttgtttgattgtctttgttataagttgtgaatttgactctcagac |
152 |
Q |
|
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
45649572 |
ttttttagtgtgtctttccatcgattataaggcttgtttgttggtctagtgtttcttgtttgattatctttgttataagttgtgaatttgactctcagac |
45649671 |
T |
 |
Q |
153 |
cgccttctctatctcattttctccctccctccctcc |
188 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| |
|
|
T |
45649672 |
cgccttctctatctcattttctccctccctccctcc |
45649707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University