View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0742_high_3 (Length: 370)
Name: NF0742_high_3
Description: NF0742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0742_high_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 142; Significance: 2e-74; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 48 - 255
Target Start/End: Complemental strand, 27798050 - 27797838
Alignment:
| Q |
48 |
aagccaaggttgtctcaaccttcaagtgtgtcagagaatgatggcgtgcttgctaaagaaagtgtttccaaaggcaagtcagaattacaaagagcat--- |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
27798050 |
aagccaaggttgtctcaaccttcaagtgtgtcagggaatgatggcgtgcttgctaaagaaagtgtttccaaaggcaagtcagaattacaaagggcatatc |
27797951 |
T |
 |
| Q |
145 |
---gtatcacatatggttctccaacattgtacaacagcnnnnnnnngttttgttgataattatttgccacgataatagtacacgatatacttattttctt |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
27797950 |
aaattatcacatatggttctccaacattgtacaacagc-tttttttgttttgttgataattatttgccacgataatagtacacgatatatttattttctt |
27797852 |
T |
 |
| Q |
242 |
ctctgtcaatacaa |
255 |
Q |
| |
|
||||| |||||||| |
|
|
| T |
27797851 |
ctctgccaatacaa |
27797838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University