View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0742_low_14 (Length: 255)
Name: NF0742_low_14
Description: NF0742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0742_low_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 1 - 247
Target Start/End: Complemental strand, 6770167 - 6769921
Alignment:
| Q |
1 |
caaaaccaacatgtagatttgaactcatgttgccatattaaggatgagtagaattttccttaattgtttgggaattattgtcgttggttgcagcaacacc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6770167 |
caaaaccaacatgtagatttgaactcatgttgccatattaaggatgagtagaattttccttaattgtttgggaattattgtcgttggttgcagcaacacc |
6770068 |
T |
|
| Q |
101 |
agaccctactacttgtgttgttcagcttttcacctttgaatttaacaacgtaatgtaatgtaatgtccccagtcaccccccacgtgctcttacagtcagt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6770067 |
agaccctactacttgtgttgttcagcttttcacctttgaatttaacaacgtaatgtaatgtaatgtccccagtcaccccccacgtgctcttacagtcagt |
6769968 |
T |
|
| Q |
201 |
cttctgccatttctgcaccccccggaccttgcttgctaccctatgct |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
6769967 |
cttctgccatttctgcaccccccggaccttgcttgctaccccatgct |
6769921 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4367 times since January 2019
Visitors: 4835