View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0743_high_103 (Length: 223)

Name: NF0743_high_103
Description: NF0743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0743_high_103
NF0743_high_103
[»] chr2 (1 HSPs)
chr2 (1-144)||(6194510-6194650)


Alignment Details
Target: chr2 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 1 - 144
Target Start/End: Original strand, 6194510 - 6194650
Alignment:
1 gtttgaagtgatggaagcacttttggatgaacctgatttttcacaaacacatcctcaaccatgtactgatacaacatggccaggaattgagtgtgaagtt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6194510 gtttgaagtgatggaagcacttttggatgaacctgatttttcacaaacacatcctcaaccatgtactgatacaacatggccaggaattgagtgtgaagtt 6194609  T
101 agcattgatgatgacaatgatacacaacaaatctttcatctcac 144  Q
    ||||||||||||   |||||||||||||||||||||||| ||||    
6194610 agcattgatgat---aatgatacacaacaaatctttcatgtcac 6194650  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University