View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0743_high_58 (Length: 362)
Name: NF0743_high_58
Description: NF0743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0743_high_58 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 92; Significance: 1e-44; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 11 - 106
Target Start/End: Complemental strand, 4903963 - 4903868
Alignment:
| Q |
11 |
gatgaactccacaacattattggtaatttgttttcttttatttttagaggaagcattgaaattaggtatagtattctggtttaaactgttgtgtgc |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
4903963 |
gatgaactccacaacattattggtaatttgttttcttttatttttagaggaagcattgaaattaggtatagaattctggtttaaactgttgtgtgc |
4903868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 201 - 272
Target Start/End: Complemental strand, 4903743 - 4903672
Alignment:
| Q |
201 |
ttggtacattgaaaacgataaagcctagacatgatagtccctaaatgcccatattttcttcttcttaaaaga |
272 |
Q |
| |
|
||||| || ||||||||||||||| |||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
4903743 |
ttggtgcaatgaaaacgataaagcttagacatgatagtccctaaatgcccagattttctccttcttaaaaga |
4903672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 309 - 357
Target Start/End: Original strand, 48767473 - 48767521
Alignment:
| Q |
309 |
ctgttgccggcaaattggttggagctactatgagaagaagtgccatggt |
357 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
48767473 |
ctgtggccggcaaattggttggagctactatgagaagaagtgccttggt |
48767521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University