View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0743_high_68 (Length: 313)
Name: NF0743_high_68
Description: NF0743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0743_high_68 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 84; Significance: 6e-40; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 8 - 118
Target Start/End: Original strand, 7419482 - 7419593
Alignment:
| Q |
8 |
aaaaacggtaacaaaactacttacaaattgttcacaacaaatattagtgga-ttttggttgattagaagttgaatctacaaccgtgtgactactttgtgt |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||| ||||| | |
|
|
| T |
7419482 |
aaaaacggtaacaaaactacttacaaattgttcacaacaaatattagtggatttttggttgactagaagttgaatctacaaccgtgtgactaatttgttt |
7419581 |
T |
|
| Q |
107 |
ggggtaagtaga |
118 |
Q |
| |
|
|| |||||||| |
|
|
| T |
7419582 |
tggttaagtaga |
7419593 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 270 - 298
Target Start/End: Original strand, 7419745 - 7419773
Alignment:
| Q |
270 |
gaagagggcatgtgttatgtttggttaat |
298 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
7419745 |
gaagagggcatgtgttatgtttggttaat |
7419773 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University