View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0743_high_73 (Length: 301)
Name: NF0743_high_73
Description: NF0743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0743_high_73 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 61 - 217
Target Start/End: Original strand, 46213370 - 46213526
Alignment:
| Q |
61 |
atttgggtcttttgttcattcttaagtcctaattaatcatgtcaaccgatcaagtttcaccattctctgttgtttctgtcgttgaagatgttcttcaaca |
160 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46213370 |
atttgggtcttttgttcattcttaaggcctaattaatcatgtcaaccgatcaagtttcaccattctctgttgtttctgtcgttgaagatgttcttcaaca |
46213469 |
T |
|
| Q |
161 |
acaaggtctccgctctagcgatttcaaatttgcttccaggaaagctgaagaggcttg |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
46213470 |
acaaggtctccgctctagcgatttcaaatttgcttccaggaaagccgaagaagcttg |
46213526 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University