View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0743_high_80 (Length: 271)
Name: NF0743_high_80
Description: NF0743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0743_high_80 |
 |  |
|
[»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 1 - 271
Target Start/End: Original strand, 54115082 - 54115352
Alignment:
Q |
1 |
tagtaccttcagtgtcccttggctcatcaaccgaggtacttatttaggactagaccttgattgatttagcgcttgtcaatgttattgaatgttcaggact |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
54115082 |
tagtaccttcagtgtcccttggctcatcaaccgaggtacttatttaggactagaccttgattgatttagcgcttgtcaatgttattgaatgttcaggact |
54115181 |
T |
 |
Q |
101 |
gagacttggtaatttgtactgtgatccactgatgatggcttgctctggacacaagataacttcgaggcagcgttggactccaatgcctatccagcttcaa |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
54115182 |
gagacttggtaatttgtactgtgatccactgatgatggcttgctctggacacaagataacttcgaggcagcgttggactccaatgcctatccagcttcaa |
54115281 |
T |
 |
Q |
201 |
atactcgagcgtattttcgatgaaggcaatggcactcccaccaaacagaagatcaaagacataaccattga |
271 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
54115282 |
atactcgagcgtattttcgatgaaggcaatggcactcccaccaaacagaagatcaaagacataaccattga |
54115352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University