View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0743_high_95 (Length: 240)
Name: NF0743_high_95
Description: NF0743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0743_high_95 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 211
Target Start/End: Original strand, 36595294 - 36595504
Alignment:
Q |
1 |
acaaagaaatgctgcaaaagtgcatgggtcccaccataaagagtactagaagccacaacatgtccgccgtggctgcagagctgtaacaaaactgcagaaa |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36595294 |
acaaagaaatgctgcaaaagtgcatgggtcccaccataaagagtactagaagccacaacatgtccgccgtggctgcagagctgtaacaaaactgcagaaa |
36595393 |
T |
 |
Q |
101 |
tggcggacatgccactggctgtacaataggcggcctcagtgccttcgagggccgccatcttacggctgagattgaggacagttgggttgaaatgacggct |
200 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
T |
36595394 |
tggcggacatgccactggctgtacaataggcggcctcagtgccttcgagggccgccatcttacggctgagattgaggacggttgggttgaaatgacggct |
36595493 |
T |
 |
Q |
201 |
gtagacgtagt |
211 |
Q |
|
|
||||||||||| |
|
|
T |
36595494 |
gtagacgtagt |
36595504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 97 - 207
Target Start/End: Complemental strand, 34809859 - 34809749
Alignment:
Q |
97 |
gaaatggcggacatgccactggctgtacaataggcggcctcagtgccttcgagggccgccatcttacggctgagattgaggacagttgggttgaaatgac |
196 |
Q |
|
|
||||||||||||||||| |||| |||||| || ||||| || || |||||||| || ||||| |||| ||| || ||||| || |||||||| |||| |
|
|
T |
34809859 |
gaaatggcggacatgccgctggatgtacagtaagcggcttctgtaccttcgagagcggccattagacgggagaggttaaggacggtagggttgaagtgac |
34809760 |
T |
 |
Q |
197 |
ggctgtagacg |
207 |
Q |
|
|
||||||||||| |
|
|
T |
34809759 |
ggctgtagacg |
34809749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University