View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0743_high_99 (Length: 230)
Name: NF0743_high_99
Description: NF0743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0743_high_99 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
| [»] scaffold0504 (1 HSPs) |
| | |
|
Alignment Details
Target: chr1 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 7 - 230
Target Start/End: Original strand, 18188662 - 18188885
Alignment:
| Q |
7 |
aagacgtctttcacactccgccggaggaagcttcacttcactcttccgacgtcgatgttcctctctgtgctgttaaccaggccgacgctgggtctcaggt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18188662 |
aagacgtctttcacactccgccggaggaagcttcacttcactcttccgacgtcgatgttcctctctgtgctgttaaccaggccgacgctgggtctcaggt |
18188761 |
T |
|
| Q |
107 |
cttcgttgattcggttgatagttcggggtttgttgattgtagaaaggattccgatttagggttttcggaggaggatcaattgaaggatgagattgatgct |
206 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
18188762 |
ctttgttgattcggttgatagttcggggtttgttgattgtagaaaggattccgatttagggttttcggaggaggatcagttgaaggatgagattgatgct |
18188861 |
T |
|
| Q |
207 |
ggttttgttcctgagaattcgcgt |
230 |
Q |
| |
|
||||||||||||||||||| |||| |
|
|
| T |
18188862 |
ggttttgttcctgagaatttgcgt |
18188885 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0504 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: scaffold0504
Description:
Target: scaffold0504; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 14 - 65
Target Start/End: Original strand, 7427 - 7478
Alignment:
| Q |
14 |
ctttcacactccgccggaggaagcttcacttcactcttccgacgtcgatgtt |
65 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||||||||||||| ||||| |
|
|
| T |
7427 |
ctttcacactccgccggagcaagcctcacttcactcttccgacgtcaatgtt |
7478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 14 - 65
Target Start/End: Complemental strand, 12027025 - 12026974
Alignment:
| Q |
14 |
ctttcacactccgccggaggaagcttcacttcactcttccgacgtcgatgtt |
65 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||||||||||||| ||||| |
|
|
| T |
12027025 |
ctttcacactccgccggagcaagcctcacttcactcttccgacgtcaatgtt |
12026974 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University