View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0743_low_100 (Length: 276)
Name: NF0743_low_100
Description: NF0743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0743_low_100 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 46 - 240
Target Start/End: Original strand, 327909 - 328103
Alignment:
Q |
46 |
cactctcgttataaacaacagacaatatagaggtatgtgacagccttccaaggttttatattgaaattgtacattaatgcaattgatttggccgcgattg |
145 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
T |
327909 |
cactctcgttataaacaacagacaatatagaggtatgtgacagccttccaaggttttatattgaaattgtacattaatgcaattgatgtggccgcgattg |
328008 |
T |
 |
Q |
146 |
cagttgcaaatatgattgtcagaatctaaaacattaatattgcacctgaaactacagtttaaaactttgaatgatcactatttaattttgtctct |
240 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
328009 |
cagttgcaaatatgattgtcagaatctaaaacattaatattgcacctgaaactacagtttaaaactttgaatgatcactatttaattttgtctct |
328103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University