View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0743_low_104 (Length: 274)
Name: NF0743_low_104
Description: NF0743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0743_low_104 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 39 - 193
Target Start/End: Original strand, 31395680 - 31395834
Alignment:
| Q |
39 |
attgaatggttaaagcaatatatgctgaaatgagaatcataaaggttacaaaaagatggagtgtaaataaaattatataggcttaaaagtaagatataat |
138 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
31395680 |
attgaatggttaaagcaatatatgctgaaatgagaatcataaaagttacaaaaagatgaagtgtaaataaaattatataggcttaaaaataagatataat |
31395779 |
T |
 |
| Q |
139 |
tttcaatttaactatatatgttggcagatacattgatgattagtacaaattggtt |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31395780 |
tttcaatttaactatatatgttggcagatacattgatgattagtacaaattggtt |
31395834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 184 - 222
Target Start/End: Original strand, 48767483 - 48767521
Alignment:
| Q |
184 |
caaattggttggagctactatgagaagaagtgccatggt |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
48767483 |
caaattggttggagctactatgagaagaagtgccttggt |
48767521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University