View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0743_low_107 (Length: 267)
Name: NF0743_low_107
Description: NF0743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0743_low_107 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 36 - 257
Target Start/End: Original strand, 45404961 - 45405182
Alignment:
| Q |
36 |
ccaagctgttagaaactctttctttctctgaatgacacttcatgtgaccgaacaaagcttgccaagagtgaaaacattttccacactctttgcagaattt |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45404961 |
ccaagctgttagaaactctttctttctctgaatgacacttcatgtgaccgaacaaagcttgccaagagtgaaaacattttccacactctttgcagaattt |
45405060 |
T |
 |
| Q |
136 |
gtcatacacataactatcttcacttgaatctgcaattctctttctccacgtcttctttggattctctcttaaaccatagctaccattagttgcagcttca |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45405061 |
gtcatacacataactatcttcacttgaatctgcaattctctttctccacgtcttctttggattctctcttaaaccatagctaccattagttgcagcttca |
45405160 |
T |
 |
| Q |
236 |
gaaccaatgctatcattctttt |
257 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
45405161 |
gaaccaatgctatcattctttt |
45405182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University