View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0743_low_110 (Length: 258)
Name: NF0743_low_110
Description: NF0743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0743_low_110 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 29 - 258
Target Start/End: Original strand, 32553166 - 32553395
Alignment:
| Q |
29 |
acattgaacaaacacaactagcattggcatgaggttccttctttgnnnnnnnctccaaaccttgactccaacatgtcacaacattgtcacatgaaggcat |
128 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32553166 |
acattgaacaaacacaactagcattggcatgaggttccttctttgtttttttctccaaaccttgactccaacatgtcacaacattgtcacatgaaggcat |
32553265 |
T |
 |
| Q |
129 |
agatgcacttcttttttcttcaatcaacatcctaaaaatgctccaacatgtcacaaatttgtatgttgaatgctccattatgtgctattaattgtagctt |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
32553266 |
agatgcacttcttttttcttcaatcaacatcctaaaaatgctccaacatgtcacaaatttgtatgttgaatgctccattatgtgctattaattgtacctt |
32553365 |
T |
 |
| Q |
229 |
aaattacttcttttggtttctatagacaaa |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
32553366 |
aaattacttcttttggtttctatagacaaa |
32553395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University