View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0743_low_115 (Length: 253)
Name: NF0743_low_115
Description: NF0743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0743_low_115 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 97; Significance: 9e-48; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 28 - 140
Target Start/End: Original strand, 13332799 - 13332911
Alignment:
| Q |
28 |
cagaagtgtgggggaacacgagggttcaaatggtatataggatgtgtatggattctataatccgaaacatacaaaacgtgcttcaaaatttataatttag |
127 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
13332799 |
cagaagtgtgggggaacatgagggttcaaatggtatataggatgtgtatggattctataatccaaaacatacaaaacgtgcatcaaaatctataatttag |
13332898 |
T |
 |
| Q |
128 |
aaattgtaatttt |
140 |
Q |
| |
|
||||||||||||| |
|
|
| T |
13332899 |
aaattgtaatttt |
13332911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 195 - 253
Target Start/End: Original strand, 13332964 - 13333026
Alignment:
| Q |
195 |
atatcacaaaacctacattatcatta----tataagtcttttattgctcaacattcacatttt |
253 |
Q |
| |
|
|||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
13332964 |
atatcataaaacctacattatcattacatatataagtcttttattgctcaacattcacatttt |
13333026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University