View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0743_low_119 (Length: 251)
Name: NF0743_low_119
Description: NF0743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0743_low_119 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 44654295 - 44654533
Alignment:
| Q |
1 |
tcaggttaaattgtttgggatcaatcgttttcactagatgtaactaatctctttttatataaaaatatgacattgctttaaactcctagagtttgttcta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
44654295 |
tcaggttaaattgtttgggatcaatcgttttcactagatgtaactaatctctttttatataaaaacatgacattgctttaaactcctagagtttgttcta |
44654394 |
T |
|
| Q |
101 |
gtaataaaaatatatgttttggactcggaggtttttggttcaagatctattaatacttttaaaatgagatagatgtatatatttactattattcgagctc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
44654395 |
gtaataaaaatatatgttttggactcggagatttttggttcaagatctattaatacttttaaaacgagatagatgtatatatttactattattcgagctc |
44654494 |
T |
|
| Q |
201 |
taatgtcttctgcttttgactaagcatcccctcaaccta |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44654495 |
taatgtcttctgcttttgactaagcatcccctcaaccta |
44654533 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University