View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0743_low_122 (Length: 250)
Name: NF0743_low_122
Description: NF0743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0743_low_122 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 12795030 - 12795270
Alignment:
| Q |
1 |
ccccgagtaaaaaggaggaataaattcccaacataaatatagataggtagaattcacaacagtgaacgtgctatagttgtgcatcaaatgagttcgatca |
100 |
Q |
| |
|
|||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||| ||||||| ||| |
|
|
| T |
12795030 |
ccccgattaaaaaggaggaataaattcccgacataaatatagataggtagaattcacaacagtgaacgtactatggttgtgcatcaaacgagttcggtca |
12795129 |
T |
|
| Q |
101 |
atttcgggccacaaacctcaaactagagttgaacaaaatatgtgtataactcagccatttctggtcgtttttgacatttgattggtcagttggcggtctg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
12795130 |
atttcgggccacaaacctcaaactagagttgaacaaaatatgtgtataactcagccatttctggtcatttttgacgtttgattggtcagttggcggtctg |
12795229 |
T |
|
| Q |
201 |
ttcagtttggaggattcactggtggg-ttattcagtctctg |
240 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||| |||| |
|
|
| T |
12795230 |
ttcagtttggaggattcactaatgggtttattcagtttctg |
12795270 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University