View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0743_low_122 (Length: 250)

Name: NF0743_low_122
Description: NF0743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0743_low_122
NF0743_low_122
[»] chr8 (1 HSPs)
chr8 (1-240)||(12795030-12795270)


Alignment Details
Target: chr8 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 12795030 - 12795270
Alignment:
1 ccccgagtaaaaaggaggaataaattcccaacataaatatagataggtagaattcacaacagtgaacgtgctatagttgtgcatcaaatgagttcgatca 100  Q
    |||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||| ||||||| |||    
12795030 ccccgattaaaaaggaggaataaattcccgacataaatatagataggtagaattcacaacagtgaacgtactatggttgtgcatcaaacgagttcggtca 12795129  T
101 atttcgggccacaaacctcaaactagagttgaacaaaatatgtgtataactcagccatttctggtcgtttttgacatttgattggtcagttggcggtctg 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||    
12795130 atttcgggccacaaacctcaaactagagttgaacaaaatatgtgtataactcagccatttctggtcatttttgacgtttgattggtcagttggcggtctg 12795229  T
201 ttcagtttggaggattcactggtggg-ttattcagtctctg 240  Q
    ||||||||||||||||||||  |||| ||||||||| ||||    
12795230 ttcagtttggaggattcactaatgggtttattcagtttctg 12795270  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University