View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0743_low_126 (Length: 240)
Name: NF0743_low_126
Description: NF0743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0743_low_126 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 36595318 - 36595087
Alignment:
| Q |
1 |
atgcacttttgcagcatttctttgtgaggacatgcaacataaccacaacttttgttgacatatccgatttggaagcagttgagaatgcaattgtggaagg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36595318 |
atgcacttttgcagcatttctttgtgaggacatgcaacataaccacaacttttgttgacatatccgatttggaagcagttgagaatgcaattgtggaagg |
36595219 |
T |
 |
| Q |
101 |
gaagaccaaagtgctgtattttgagtcaattgcaaatccaagcttgaatgtggccaatactcctgagctagctaggattgcacacaaaaagggagtgact |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||| |
|
|
| T |
36595218 |
gaagaccaaagtgctgtattttgagtcaattgcaaatccaagcttgaatgtggccaatactcctgagcttgctaggattgcacacaaaaagggagtaact |
36595119 |
T |
 |
| Q |
201 |
gtggtggttgataacacctttgctcctatgct |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
36595118 |
gtggtggttgataacacctttgctcctatgct |
36595087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University