View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0743_low_136 (Length: 223)
Name: NF0743_low_136
Description: NF0743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0743_low_136 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 1 - 144
Target Start/End: Original strand, 6194510 - 6194650
Alignment:
| Q |
1 |
gtttgaagtgatggaagcacttttggatgaacctgatttttcacaaacacatcctcaaccatgtactgatacaacatggccaggaattgagtgtgaagtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6194510 |
gtttgaagtgatggaagcacttttggatgaacctgatttttcacaaacacatcctcaaccatgtactgatacaacatggccaggaattgagtgtgaagtt |
6194609 |
T |
|
| Q |
101 |
agcattgatgatgacaatgatacacaacaaatctttcatctcac |
144 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
6194610 |
agcattgatgat---aatgatacacaacaaatctttcatgtcac |
6194650 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University