View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0743_low_140 (Length: 220)
Name: NF0743_low_140
Description: NF0743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0743_low_140 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 101 - 219
Target Start/End: Original strand, 41703567 - 41703685
Alignment:
| Q |
101 |
atgacaacgacgatgatcaatctatctctagaggagtacatgaaaagaaagcatgttctggaatcaccgcaaatccatgttcatcagtggcactggcaac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41703567 |
atgacaacgacgatgatcaatctatctctagaggagtacatgaaaagaaagcatgttctggaatcaccgcaaatccatgttcatcagtggcactggcaac |
41703666 |
T |
|
| Q |
201 |
acaacaagaaagcaaattt |
219 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
41703667 |
acaacaagaaagcaaattt |
41703685 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University