View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0743_low_142 (Length: 218)
Name: NF0743_low_142
Description: NF0743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0743_low_142 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 115; Significance: 1e-58; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 79 - 209
Target Start/End: Complemental strand, 19426538 - 19426408
Alignment:
| Q |
79 |
aagaatatcccaagaatgtgtagtgtggagcttactcattttgctctcaaaaacagacacaactgaatcatattctgaaacataatccaaaacattgatc |
178 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19426538 |
aagaaaatcccaagaatgtgtagtgtggagcttacttattttgctctcaaaaacagacacaactgaatcatattctgaaacataatccaaaacattgatc |
19426439 |
T |
 |
| Q |
179 |
agaagattctttcagataaagtaagaagata |
209 |
Q |
| |
|
|||||||||||||| ||||||||| |||||| |
|
|
| T |
19426438 |
agaagattctttcaaataaagtaaaaagata |
19426408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 79 - 182
Target Start/End: Complemental strand, 19419832 - 19419729
Alignment:
| Q |
79 |
aagaatatcccaagaatgtgtagtgtggagcttactcattttgctctcaaaaacagacacaactgaatcatattctgaaacataatccaaaacattgatc |
178 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19419832 |
aagaaaatcccaagaatgtgtagtgtggagcttactcattttgctctcaaaaacagacacaactgaatcatattctgaaacataatccaaaacattgatc |
19419733 |
T |
 |
| Q |
179 |
agaa |
182 |
Q |
| |
|
|||| |
|
|
| T |
19419732 |
agaa |
19419729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University