View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0743_low_144 (Length: 215)
Name: NF0743_low_144
Description: NF0743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0743_low_144 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 64; Significance: 4e-28; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 41531258 - 41531325
Alignment:
| Q |
1 |
catgcctactattgtgttaccattggaatcttctatctataaattgaaagcaaaacattttattcatc |
68 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41531258 |
catgcccactattgtgttaccattggaatcttctatctataaattgaaagcaaaacattttattcatc |
41531325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University