View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0743_low_149 (Length: 210)

Name: NF0743_low_149
Description: NF0743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0743_low_149
NF0743_low_149
[»] chr8 (1 HSPs)
chr8 (1-91)||(29313322-29313412)
[»] chr4 (1 HSPs)
chr4 (11-91)||(16983140-16983224)


Alignment Details
Target: chr8 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 29313322 - 29313412
Alignment:
1 acttagcacgattgttctattctctcaattgataatcaatcaccatgtctttgcttctaagatcaaccaaatcgaagttgttcttatcttc 91  Q
    ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
29313322 acttagctcgattgttctattctctcaattgataatcaatcaccatgtctttgcttctaagatcaaccaaatcgaagttgctcttatcttc 29313412  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 11 - 91
Target Start/End: Complemental strand, 16983224 - 16983140
Alignment:
11 attgttctattctctcaattgataatcaatca----ccatgtctttgcttctaagatcaaccaaatcgaagttgttcttatcttc 91  Q
    ||||||||||||||| ||||||||||||||||    ||||||||| |||||| |||||||| ||||| ||| | |||||||||||    
16983224 attgttctattctctgaattgataatcaatcaatcaccatgtcttggcttctcagatcaacaaaatcaaagctcttcttatcttc 16983140  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University