View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0743_low_149 (Length: 210)
Name: NF0743_low_149
Description: NF0743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0743_low_149 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 29313322 - 29313412
Alignment:
| Q |
1 |
acttagcacgattgttctattctctcaattgataatcaatcaccatgtctttgcttctaagatcaaccaaatcgaagttgttcttatcttc |
91 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
29313322 |
acttagctcgattgttctattctctcaattgataatcaatcaccatgtctttgcttctaagatcaaccaaatcgaagttgctcttatcttc |
29313412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 11 - 91
Target Start/End: Complemental strand, 16983224 - 16983140
Alignment:
| Q |
11 |
attgttctattctctcaattgataatcaatca----ccatgtctttgcttctaagatcaaccaaatcgaagttgttcttatcttc |
91 |
Q |
| |
|
||||||||||||||| |||||||||||||||| ||||||||| |||||| |||||||| ||||| ||| | ||||||||||| |
|
|
| T |
16983224 |
attgttctattctctgaattgataatcaatcaatcaccatgtcttggcttctcagatcaacaaaatcaaagctcttcttatcttc |
16983140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University