View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0743_low_151 (Length: 210)
Name: NF0743_low_151
Description: NF0743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0743_low_151 |
 |  |
|
[»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 88 - 210
Target Start/End: Original strand, 5979903 - 5980025
Alignment:
Q |
88 |
atgaatgaatatatgtaccttaaaatttaagtaatttatttttattattttggtcgaaccgacaccaattaggtcactgtctcggccgtaagaatgctaa |
187 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||| |
|
|
T |
5979903 |
atgaatgaatatatgtaccttaaaatttaagtaatttatttttattattttggtcgaaccgacaccaattaggtcaccgtctcggccgtaaaaatgctaa |
5980002 |
T |
 |
Q |
188 |
agaccataaacttctaccgttaa |
210 |
Q |
|
|
||||||||||||||||||||||| |
|
|
T |
5980003 |
agaccataaacttctaccgttaa |
5980025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University