View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0743_low_157 (Length: 208)
Name: NF0743_low_157
Description: NF0743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0743_low_157 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 77; Significance: 6e-36; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 77; E-Value: 6e-36
Query Start/End: Original strand, 36 - 112
Target Start/End: Original strand, 4365158 - 4365234
Alignment:
Q |
36 |
tgacacttgatcctgccgaacatatttacctttctctttctatggcacttttggaaagactcctccgtatcttatct |
112 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4365158 |
tgacacttgatcctgccgaacatatttacctttctctttctatggcacttttggaaagactcctccgtatcttatct |
4365234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 40 - 112
Target Start/End: Original strand, 4369556 - 4369628
Alignment:
Q |
40 |
acttgatcctgccgaacatatttacctttctctttctatggcacttttggaaagactcctccgtatcttatct |
112 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4369556 |
acttgatcctgccgaacatatttacctttctctttctatggcacttttggaaagactcctccgtatcttatct |
4369628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 44 - 107
Target Start/End: Original strand, 4359773 - 4359836
Alignment:
Q |
44 |
gatcctgccgaacatatttacctttctctttctatggcacttttggaaagactcctccgtatct |
107 |
Q |
|
|
|||||||||||||||||||||||||| |||||| || || || |||||||||| || |||||| |
|
|
T |
4359773 |
gatcctgccgaacatatttacctttccctttctttgtcatcttcggaaagactcttctgtatct |
4359836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University