View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0743_low_159 (Length: 204)
Name: NF0743_low_159
Description: NF0743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0743_low_159 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 125; Significance: 1e-64; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 125; E-Value: 1e-64
Query Start/End: Original strand, 1 - 129
Target Start/End: Original strand, 9051332 - 9051460
Alignment:
| Q |
1 |
ttgaagagagaccaaaatggctagatagatggatggctacaaaaccgtgggagaatagaggaagggcttcaaccgatcaaagagactctattaagactgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9051332 |
ttgaagagagaccaaaatggctagatagatggatggctacaaaaccgtgggagaataggggaagggcttcaaccgatcaaagagactctattaagactgt |
9051431 |
T |
 |
| Q |
101 |
ggaagtcgacacatctcaaccttattcat |
129 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
9051432 |
ggaagtcgacacatctcaaccttattcat |
9051460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University