View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0743_low_16 (Length: 531)
Name: NF0743_low_16
Description: NF0743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0743_low_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 89; Significance: 1e-42; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 89; E-Value: 1e-42
Query Start/End: Original strand, 371 - 471
Target Start/End: Complemental strand, 22550380 - 22550280
Alignment:
Q |
371 |
gtcagggctggtggtttgcaagacaaagagggaggtatccgtgaactcgtcatagggaaggacgatgagcttctaaagactgacatcagaaccatagcta |
470 |
Q |
|
|
||||| |||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
22550380 |
gtcagagctggtggcttgcaagacaaggagggaggtatccgtgaactcgtcatagggaaggacgatgagcttctaaagactgacatcagaaccatagcta |
22550281 |
T |
 |
Q |
471 |
g |
471 |
Q |
|
|
| |
|
|
T |
22550280 |
g |
22550280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 79; E-Value: 1e-36
Query Start/End: Original strand, 13 - 123
Target Start/End: Complemental strand, 22550868 - 22550758
Alignment:
Q |
13 |
aatatctggctgactctggtattccatatacgattattaggtataccggtttctattatactgaacaatatctgtacgattccggtattccatatacgat |
112 |
Q |
|
|
||||||| ||||| ||||||||||||||||||||||| ||||| ||||||||||||||||| |||||||||||||| ||||||||||||| |||||||| |
|
|
T |
22550868 |
aatatcttgctgattctggtattccatatacgattataaggtacaccggtttctattataccgaacaatatctgtatgattccggtattctgtatacgat |
22550769 |
T |
 |
Q |
113 |
tatatatagga |
123 |
Q |
|
|
||||||||||| |
|
|
T |
22550768 |
tatatatagga |
22550758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 478 - 526
Target Start/End: Original strand, 48767473 - 48767521
Alignment:
Q |
478 |
ctgttgccggcaaattggttggagctactatgagaagaggtgccatggt |
526 |
Q |
|
|
|||| ||||||||||||||||||||||||||||||||| ||||| |||| |
|
|
T |
48767473 |
ctgtggccggcaaattggttggagctactatgagaagaagtgccttggt |
48767521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University