View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0743_low_64 (Length: 369)
Name: NF0743_low_64
Description: NF0743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0743_low_64 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 102; Significance: 1e-50; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 157 - 270
Target Start/End: Complemental strand, 7348361 - 7348248
Alignment:
| Q |
157 |
tagaaggagaagatgttgaagaggaagaaccagtgatgattgtaattgataagatacgtcaggagagggaggtatctccgttggataatcttctgaagat |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
7348361 |
tagaaggagaagatgttgaagaggaagaaccggtgatgattgtaattgataagttacgtcaggagagggaggtatctccgttggataatcttttgaagat |
7348262 |
T |
|
| Q |
257 |
tttgaagtatttga |
270 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
7348261 |
tttgaagtatttga |
7348248 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University