View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0743_low_67 (Length: 362)

Name: NF0743_low_67
Description: NF0743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0743_low_67
NF0743_low_67
[»] chr7 (2 HSPs)
chr7 (11-106)||(4903868-4903963)
chr7 (201-272)||(4903672-4903743)
[»] chr3 (1 HSPs)
chr3 (309-357)||(48767473-48767521)


Alignment Details
Target: chr7 (Bit Score: 92; Significance: 1e-44; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 11 - 106
Target Start/End: Complemental strand, 4903963 - 4903868
Alignment:
11 gatgaactccacaacattattggtaatttgttttcttttatttttagaggaagcattgaaattaggtatagtattctggtttaaactgttgtgtgc 106  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
4903963 gatgaactccacaacattattggtaatttgttttcttttatttttagaggaagcattgaaattaggtatagaattctggtttaaactgttgtgtgc 4903868  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 201 - 272
Target Start/End: Complemental strand, 4903743 - 4903672
Alignment:
201 ttggtacattgaaaacgataaagcctagacatgatagtccctaaatgcccatattttcttcttcttaaaaga 272  Q
    ||||| || ||||||||||||||| |||||||||||||||||||||||||| ||||||| ||||||||||||    
4903743 ttggtgcaatgaaaacgataaagcttagacatgatagtccctaaatgcccagattttctccttcttaaaaga 4903672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 309 - 357
Target Start/End: Original strand, 48767473 - 48767521
Alignment:
309 ctgttgccggcaaattggttggagctactatgagaagaagtgccatggt 357  Q
    |||| ||||||||||||||||||||||||||||||||||||||| ||||    
48767473 ctgtggccggcaaattggttggagctactatgagaagaagtgccttggt 48767521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University