View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0743_low_86 (Length: 317)
Name: NF0743_low_86
Description: NF0743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0743_low_86 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 82; Significance: 1e-38; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 82 - 179
Target Start/End: Complemental strand, 5266754 - 5266657
Alignment:
| Q |
82 |
gatgccaaacttgtttgtgacaatgaacacacttttatgcaaatttatgctgattttgcgacacaaataagaccatagtagtggcacaaatcaaactg |
179 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5266754 |
gatgccgaacttgtttgcgacaatgaacacacttttatgcaaagttacgctgattttgcgacacaaataagaccatagtagtggcacaaatcaaactg |
5266657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University