View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0743_low_87 (Length: 316)
Name: NF0743_low_87
Description: NF0743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0743_low_87 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 156; Significance: 7e-83; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 156; E-Value: 7e-83
Query Start/End: Original strand, 79 - 316
Target Start/End: Complemental strand, 30596989 - 30596753
Alignment:
| Q |
79 |
gaacgaaaggatagagaaaaggttgatagaaatttgaaannnnnnnctcagatttgtgaatatagaaaacggagttttgatttgtggtagagaaagagtt |
178 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||||||| ||||||||||||| ||||||||||||| ||||||||||||||||||||| ||| |
|
|
| T |
30596989 |
gaacgaaaggacagagaaagggttgatagaaatttgaaatttttt-ctcagatttgtgagtatagaaaacggatttttgatttgtggtagagaaacggtt |
30596891 |
T |
 |
| Q |
179 |
gtcagggttgtgttgctgaggaagctgggtttattgaagtaatgattttaggggtttgattttctaaccctttgatttttgtgtgcctttgtttgagggg |
278 |
Q |
| |
|
|||| |||| ||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
30596890 |
gtcacggttatgttgatgaggaagctgggtttattgaagtaatgattttaggggtttggttttctaaccctttgatttttgcgtgcctttgtttgagggg |
30596791 |
T |
 |
| Q |
279 |
ttctgattcccctttttgatctttgagcttcatcccac |
316 |
Q |
| |
|
||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
30596790 |
ttccgattccccttttgtatctttgagcttcatcccac |
30596753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 186 - 245
Target Start/End: Original strand, 7821353 - 7821412
Alignment:
| Q |
186 |
ttgtgttgctgaggaagctgggtttattgaagtaatgattttaggggtttgattttctaa |
245 |
Q |
| |
|
|||||||| |||||||| || |||| ||||||||||||||||||||||||| |||||||| |
|
|
| T |
7821353 |
ttgtgttgatgaggaagttgagtttcttgaagtaatgattttaggggtttggttttctaa |
7821412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 185 - 229
Target Start/End: Original strand, 14391967 - 14392011
Alignment:
| Q |
185 |
gttgtgttgctgaggaagctgggtttattgaagtaatgattttag |
229 |
Q |
| |
|
|||||||||||||||||| || |||| |||||||||||||||||| |
|
|
| T |
14391967 |
gttgtgttgctgaggaagttgagtttcttgaagtaatgattttag |
14392011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University