View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0743_low_94 (Length: 299)
Name: NF0743_low_94
Description: NF0743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0743_low_94 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 183; Significance: 5e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 53 - 239
Target Start/End: Complemental strand, 3611890 - 3611704
Alignment:
Q |
53 |
gagtgagatgaatggtttccagaggttgaggagctccccttcatatcatacaaaatttccccagccaagtttacattccgatttgccttgcaataggcat |
152 |
Q |
|
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3611890 |
gagttagatgaatggtttccagaggttgaggagctccccttcatatcatacaaaatttccccagccaagtttacattccgatttgccttgcaataggcat |
3611791 |
T |
 |
Q |
153 |
gagctatatcgtcaagtgaacacgaacctccaaagacatcatacaggcacttcaacgcctgatcttcatcatatgcaaccatgttct |
239 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3611790 |
gagctatatcgtcaagtgaacacgaacctccaaagacatcatacaggcacttcaacgcctgatcttcatcatatgcaaccatgttct |
3611704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University