View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0743_low_95 (Length: 297)
Name: NF0743_low_95
Description: NF0743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0743_low_95 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 13 - 232
Target Start/End: Complemental strand, 39066649 - 39066437
Alignment:
| Q |
13 |
aatataaacatttaagttttgtgtagtgacagaatcaaccatattagtgattgttggatcaacatcagtcgtcttatcctaactcgattattttaatatt |
112 |
Q |
| |
|
||||||| || |||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39066649 |
aatataagcacttaagttttgtgcagtgacagaatcaaccatattagtgattgttggatcaagatcagtcgtcttatcctaactcgattattttaatatt |
39066550 |
T |
|
| Q |
113 |
ttaaaataatccaaatatatactgcaatacaaacagaaagatctctattctctactttgaccggttaccgactccatgactagttgtaacttggttaaaa |
212 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||| ||||| ||| |||||| ||||||||||||||| |||| ||||||||| |||||||||| |
|
|
| T |
39066549 |
ttaaaataatcaaaatatatactgaaatacaaacaaaaaga-------tctttactttcaccggttaccgactctatgattagttgtaatttggttaaaa |
39066457 |
T |
|
| Q |
213 |
ttggtgtgaaatgtcttaaa |
232 |
Q |
| |
|
||| |||||||||||||||| |
|
|
| T |
39066456 |
ttgatgtgaaatgtcttaaa |
39066437 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 244 - 292
Target Start/End: Original strand, 48767473 - 48767521
Alignment:
| Q |
244 |
ctgttgccggcaaattggttggagctactatgagaagaagtgccatggt |
292 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
48767473 |
ctgtggccggcaaattggttggagctactatgagaagaagtgccttggt |
48767521 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University