View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0743_low_96 (Length: 296)
Name: NF0743_low_96
Description: NF0743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0743_low_96 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 134; Significance: 9e-70; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 134; E-Value: 9e-70
Query Start/End: Original strand, 74 - 250
Target Start/End: Original strand, 9201568 - 9201743
Alignment:
| Q |
74 |
gaatgtctaaccgagaataaggagtatatttgaaacaaaattagtgaatgaaattacaaaattacatatatggtcaagattatttcaatagtcaaattgt |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9201568 |
gaatgtctaaccgagaataaggagtatatttgaaacaaaattagtgaatgaaattacaaaattacatatatggtcaagattatttcaatagtcaaattgt |
9201667 |
T |
|
| Q |
174 |
aggnnnnnnnnngtataaatgggatacatatgccaactaattgcagaccaaaaacttatagtcaaagtcaatgagat |
250 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9201668 |
agggaaaaaaaa-agtaaatgggatacatatgccaactaattgcagaccaaaaacttatagtcaaagtcaatgagat |
9201743 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 101 - 141
Target Start/End: Original strand, 9173470 - 9173510
Alignment:
| Q |
101 |
atttgaaacaaaattagtgaatgaaattacaaaattacata |
141 |
Q |
| |
|
||||||||||||||||||| || | |||||||||||||||| |
|
|
| T |
9173470 |
atttgaaacaaaattagtgtattagattacaaaattacata |
9173510 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University