View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0744_high_13 (Length: 252)
Name: NF0744_high_13
Description: NF0744
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0744_high_13 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 26 - 224
Target Start/End: Original strand, 43454642 - 43454840
Alignment:
| Q |
26 |
tgtttcatgattacagttattgaaacaaactataacttttatagcactctggcagataataggtttcttattttatctattatagttgtttacatattta |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
43454642 |
tgtttcatgattacagttattgaaacaaactataacttttatagcactctggcagataatagatttcttattttatctgttatagttgtttacatattta |
43454741 |
T |
|
| Q |
126 |
tttccttaaaatcaccagaaaataaattaccgcagactgaaactctccatttatgcaattacctagagggagacttgggtgtgtgagcatgagttagat |
224 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
43454742 |
tttccttaaaaccaccagaaaataaattaccgcagactgaaactctccatttatgcaattacctagagggagacttgggtgtgtgagcatgagctagat |
43454840 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5404 times since January 2019
Visitors: 4850