View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0744_high_14 (Length: 251)
Name: NF0744_high_14
Description: NF0744
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0744_high_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 100; Significance: 1e-49; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 1 - 100
Target Start/End: Complemental strand, 36204775 - 36204676
Alignment:
Q |
1 |
cacttgtatacattaaaccttatagcacatgcccttgtgagagttgtgctgtgtctaatacatataatctctaacttttatctccctcattcaaagttat |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36204775 |
cacttgtatacattaaaccttatagcacatgcccttgtgagagttgtgctgtgtctaatacatataatctctaacttttatctccctcattcaaagttat |
36204676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 166 - 223
Target Start/End: Complemental strand, 36204609 - 36204552
Alignment:
Q |
166 |
cacaagccttaaataaccctaattatgtagtacaagaaagaagtttcaagctaatcat |
223 |
Q |
|
|
||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
T |
36204609 |
cacaagctttaaataaccctaattatatagtacaagaaagaagtttcaagctaatcat |
36204552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University