View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0744_high_15 (Length: 247)
Name: NF0744_high_15
Description: NF0744
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0744_high_15 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 139; Significance: 8e-73; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 4 - 230
Target Start/End: Original strand, 36204861 - 36205096
Alignment:
| Q |
4 |
ctagctatacaacatttatgagtcnnnnnnngcatattttgtgatgtatctgcaaaatctatctaactaaaagatttcatgaattatagtgatctaatt- |
102 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| ||||||||||||||||| | |||||||||||||||||||||||||||||||||||| |
|
|
| T |
36204861 |
ctagctatacaacatttatgagtctttttt-gcatattttgtaatgtatctgcaaaatctttgtaactaaaagatttcatgaattatagtgatctaatta |
36204959 |
T |
|
| Q |
103 |
-------tcagtacaatagcttgacagtacctccatgatatgagagttatttgacagttgttagtttcgtgcaattttatacaatagtttc--agtgtgt |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
36204960 |
atggtattcagtacaatagcttgacagtacctccatgatatgagagtcttttgacagttgatagtttcgtgcaattttatacaatagtttcatagtgtgt |
36205059 |
T |
|
| Q |
194 |
gtcaccgtgattttttcaaattcattgtgattccaaa |
230 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
36205060 |
gtcatcgtgattttttcaaactcattgtgattccaaa |
36205096 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4803 times since January 2019
Visitors: 4839