View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0744_high_16 (Length: 242)

Name: NF0744_high_16
Description: NF0744
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0744_high_16
NF0744_high_16
[»] chr1 (1 HSPs)
chr1 (1-133)||(49774209-49774341)


Alignment Details
Target: chr1 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 1 - 133
Target Start/End: Complemental strand, 49774341 - 49774209
Alignment:
1 tctctgcaacaatattggcactcgtattttctttcaccggaggaaggtgggaaagtttcgttgataccagaggagtccggtgatcttgatggtgaagttg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49774341 tctctgcaacaatattggcactcgtattttctttcaccggaggaaggtgggaaagtttcgttgataccagaggagtccggtgatcttgatggtgaagttg 49774242  T
101 aggtggaagaagaagttgttttggttgttgttg 133  Q
    |||||||||||||||||||||||||||||||||    
49774241 aggtggaagaagaagttgttttggttgttgttg 49774209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University