View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0744_high_4 (Length: 407)
Name: NF0744_high_4
Description: NF0744
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0744_high_4 |
 |  |
|
[»] scaffold0019 (1 HSPs) |
 |  |  |
|
[»] scaffold0426 (1 HSPs) |
 |  |  |
|
[»] scaffold0003 (1 HSPs) |
 |  |  |
|
[»] scaffold0354 (1 HSPs) |
 |  |  |
|
[»] scaffold0066 (1 HSPs) |
 |  |  |
|
[»] scaffold0038 (1 HSPs) |
 |  |  |
|
[»] scaffold1127 (1 HSPs) |
 |  |  |
|
[»] scaffold0445 (1 HSPs) |
 |  |  |
|
[»] scaffold0016 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr2 (Bit Score: 150; Significance: 3e-79; HSPs: 57)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 150; E-Value: 3e-79
Query Start/End: Original strand, 168 - 385
Target Start/End: Original strand, 8727716 - 8727931
Alignment:
Q |
168 |
cccagactttacatatattatgcattgtttctaccaactgaactaagcttatgaggacg-aaagaggatggttaacaacaaaacaatgaatcgttaaatc |
266 |
Q |
|
|
|||||||||||||||||||||||||||||||||| |||||| |||||||||||| |||| |||||||| ||||||||||||||||||||||||||||||| |
|
|
T |
8727716 |
cccagactttacatatattatgcattgtttctactaactgagctaagcttatgaagacggaaagaggacggttaacaacaaaacaatgaatcgttaaatc |
8727815 |
T |
 |
Q |
267 |
aaacaggatgcacacnnnnnnnnnnnnctatgaatgaaatttacaaactaattttccattaatgaactatttgttacaattaggttctgtttggtttaac |
366 |
Q |
|
|
||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8727816 |
aaacaggatgcacac---aaaaaaaagctatgaatgaaatttacaaactaaatttccattaatgaactatttgttacaattaggttctgtttggtttaac |
8727912 |
T |
 |
Q |
367 |
gattcgatttaattttcag |
385 |
Q |
|
|
||||||||||||||||||| |
|
|
T |
8727913 |
gattcgatttaattttcag |
8727931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 150 - 213
Target Start/End: Original strand, 25274821 - 25274884
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaa |
213 |
Q |
|
|
||||| ||||||||||||||||||| ||||||||||||||||||||| |||||||||| |||| |
|
|
T |
25274821 |
ggtgttcggggttcgaaccccagaccttacatatattatgcattgttcttaccaactgagctaa |
25274884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 159 - 226
Target Start/End: Complemental strand, 41668715 - 41668648
Alignment:
Q |
159 |
ggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgaggacg |
226 |
Q |
|
|
||||||||| ||||||||| |||||||||||||||||| |||||||||| ||||||||||| ||||| |
|
|
T |
41668715 |
ggttcgaacgccagactttgcatatattatgcattgttcataccaactgagctaagcttatgtggacg |
41668648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 162 - 225
Target Start/End: Original strand, 18782544 - 18782607
Alignment:
Q |
162 |
tcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
||||||||||||| || |||||||||||||||||||||||||||| | |||| || |||||||| |
|
|
T |
18782544 |
tcgaaccccagaccttgcatatattatgcattgtttctaccaacttagctaaactcatgaggac |
18782607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 150 - 225
Target Start/End: Complemental strand, 34903586 - 34903511
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
||||||||||||||||||| ||||| || ||||||||||||| ||| |||||||||||||||||| ||| |||| |
|
|
T |
34903586 |
ggtgtccggggttcgaacctcagaccttgcatatattatgcactgtccttaccaactgaactaagctcatggggac |
34903511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 169 - 214
Target Start/End: Original strand, 30799099 - 30799144
Alignment:
Q |
169 |
ccagactttacatatattatgcattgtttctaccaactgaactaag |
214 |
Q |
|
|
|||||| |||||||||||||||||||||||||||||||||| |||| |
|
|
T |
30799099 |
ccagaccttacatatattatgcattgtttctaccaactgaaataag |
30799144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 158 - 226
Target Start/End: Complemental strand, 7201568 - 7201500
Alignment:
Q |
158 |
gggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgaggacg |
226 |
Q |
|
|
|||||||||| ||||||||| |||||||||||||||||| ||||||||| ||||||| | ||||||| |
|
|
T |
7201568 |
gggttcgaactccagactttgcatatattatgcattgttcaaaccaactgagctaagctcacgaggacg |
7201500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 150 - 214
Target Start/End: Original strand, 24592838 - 24592902
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaag |
214 |
Q |
|
|
|||| |||||||| ||||||||||| || ||||||||||||||||| ||||||||||| ||||| |
|
|
T |
24592838 |
ggtggccggggtttgaaccccagaccttgcatatattatgcattgtccctaccaactgagctaag |
24592902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 150 - 214
Target Start/End: Complemental strand, 26999179 - 26999115
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaag |
214 |
Q |
|
|
|||| |||| ||| ||||| ||||| || ||||||||||||||||| |||||||||||||||||| |
|
|
T |
26999179 |
ggtggccggagtttgaaccgcagaccttgcatatattatgcattgtctctaccaactgaactaag |
26999115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 171 - 223
Target Start/End: Original strand, 34191321 - 34191373
Alignment:
Q |
171 |
agactttacatatattatgcattgtttctaccaactgaactaagcttatgagg |
223 |
Q |
|
|
||||||||||||||||||||||||| ||||||||||| ||||||| |||||| |
|
|
T |
34191321 |
agactttacatatattatgcattgtccctaccaactgagctaagctcatgagg |
34191373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 150 - 225
Target Start/End: Complemental strand, 2257040 - 2256965
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
|||| |||||||||||||||||||| || ||||||||||||||||| |||||||||| |||||| | |||||| |
|
|
T |
2257040 |
ggtggccggggttcgaaccccagaccttgcatatattatgcattgtccataccaactgagttaagctcacgaggac |
2256965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 150 - 205
Target Start/End: Complemental strand, 42102156 - 42102101
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaac |
205 |
Q |
|
|
|||| |||||||||||||| ||||| |||||||||||||||||| ||| ||||||| |
|
|
T |
42102156 |
ggtggccggggttcgaaccacagacattacatatattatgcattatttataccaac |
42102101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 157 - 216
Target Start/End: Complemental strand, 44111012 - 44110953
Alignment:
Q |
157 |
ggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagct |
216 |
Q |
|
|
|||||| |||||| |||||||||||||| |||||| |||| ||||||||||| ||||||| |
|
|
T |
44111012 |
ggggtttgaaccctagactttacatatactatgcactgttcctaccaactgagctaagct |
44110953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 153 - 195
Target Start/End: Original strand, 11810377 - 11810419
Alignment:
Q |
153 |
gtccggggttcgaaccccagactttacatatattatgcattgt |
195 |
Q |
|
|
||||||||||||||||||||||||| || |||||||||||||| |
|
|
T |
11810377 |
gtccggggttcgaaccccagactttgcacatattatgcattgt |
11810419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 150 - 216
Target Start/End: Complemental strand, 24393314 - 24393248
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagct |
216 |
Q |
|
|
||||||||||||||||||| ||||| || ||||||||||||||||| || ||||||| ||||||| |
|
|
T |
24393314 |
ggtgtccggggttcgaacctcagaccttgcatatattatgcattgtccttaacaactgagctaagct |
24393248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 150 - 208
Target Start/End: Complemental strand, 27152422 - 27152364
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactga |
208 |
Q |
|
|
||||||| ||||||||||||||||| || ||||||||||||||| | ||||||||||| |
|
|
T |
27152422 |
ggtgtcctgggttcgaaccccagaccttgcatatattatgcattatccctaccaactga |
27152364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 156 - 209
Target Start/End: Original strand, 29896292 - 29896345
Alignment:
Q |
156 |
cggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaa |
209 |
Q |
|
|
||||||| |||||||| || || |||||||||||||||||||||| |||||||| |
|
|
T |
29896292 |
cggggtttgaaccccaaaccttgcatatattatgcattgtttctatcaactgaa |
29896345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 156 - 225
Target Start/End: Original strand, 42475108 - 42475177
Alignment:
Q |
156 |
cggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
||||||||||||| ||||| || ||||| ||||||||||||| |||||||||| |||||| | |||||| |
|
|
T |
42475108 |
cggggttcgaacctcagaccttgcatattttatgcattgtttataccaactgagttaagctcacgaggac |
42475177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 156 - 216
Target Start/End: Complemental strand, 17142893 - 17142833
Alignment:
Q |
156 |
cggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagct |
216 |
Q |
|
|
||||||| |||| ||||||||| |||||||||| |||||| ||||||||||| ||||||| |
|
|
T |
17142893 |
cggggtttgaactccagactttgcatatattatacattgtcactaccaactgagctaagct |
17142833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 152 - 216
Target Start/End: Complemental strand, 22608594 - 22608530
Alignment:
Q |
152 |
tgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagct |
216 |
Q |
|
|
|||| |||||| ||||| || || || ||||||||||||||||| |||||||||||| ||||||| |
|
|
T |
22608594 |
tgtctggggtttgaacctcataccttgcatatattatgcattgtctctaccaactgagctaagct |
22608530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 156 - 208
Target Start/End: Original strand, 27412834 - 27412886
Alignment:
Q |
156 |
cggggttcgaaccccagactttacatatattatgcattgtttctaccaactga |
208 |
Q |
|
|
||||||| |||| ||||| |||||||||||||||||||| |||||||||||| |
|
|
T |
27412834 |
cggggtttgaacaacagaccttacatatattatgcattgtctctaccaactga |
27412886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 156 - 216
Target Start/End: Original strand, 40896507 - 40896567
Alignment:
Q |
156 |
cggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagct |
216 |
Q |
|
|
|||||||||||| |||||||| |||||||||||||||| | |||||||||| ||||||| |
|
|
T |
40896507 |
cggggttcgaacttcagactttgtatatattatgcattgtctataccaactgagctaagct |
40896567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 150 - 193
Target Start/End: Complemental strand, 2264866 - 2264823
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcatt |
193 |
Q |
|
|
||||||| |||||||||||||| || |||||||||||||||||| |
|
|
T |
2264866 |
ggtgtccagggttcgaaccccaaaccttacatatattatgcatt |
2264823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 155 - 214
Target Start/End: Original strand, 4927446 - 4927505
Alignment:
Q |
155 |
ccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaag |
214 |
Q |
|
|
|||||||| ||||||| ||| ||||||||||||||| |||| ||||||||||| ||||| |
|
|
T |
4927446 |
ccggggtttgaaccccggaccttacatatattatgctttgtccctaccaactgagctaag |
4927505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 155 - 206
Target Start/End: Original strand, 6579278 - 6579329
Alignment:
Q |
155 |
ccggggttcgaaccccagactttacatatattatgcattgtttctaccaact |
206 |
Q |
|
|
||||| |||||||||||||| || |||||||||||||||||| |||||||| |
|
|
T |
6579278 |
ccgggattcgaaccccagaccttgcatatattatgcattgttcttaccaact |
6579329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 159 - 218
Target Start/End: Complemental strand, 6765670 - 6765611
Alignment:
Q |
159 |
ggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagctta |
218 |
Q |
|
|
|||||||||||| ||| |||||||| ||||||||||| |||||||||| ||||||||| |
|
|
T |
6765670 |
ggttcgaaccccggaccttacatattttatgcattgtccataccaactgagctaagctta |
6765611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 150 - 225
Target Start/End: Original strand, 10735823 - 10735898
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
|||| |||||||| ||||||| ||| || |||||||||||||| || ||||||||||| ||||||| | |||||| |
|
|
T |
10735823 |
ggtggccggggtttgaaccccggaccttgcatatattatgcatcgtccctaccaactgagctaagctcacgaggac |
10735898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 157 - 216
Target Start/End: Original strand, 20565074 - 20565133
Alignment:
Q |
157 |
ggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagct |
216 |
Q |
|
|
|||||| ||||||| ||| || ||||||||||||||||| ||||||||||| ||||||| |
|
|
T |
20565074 |
ggggtttgaaccccggaccttgcatatattatgcattgtccctaccaactgagctaagct |
20565133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 150 - 193
Target Start/End: Complemental strand, 22607221 - 22607178
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcatt |
193 |
Q |
|
|
||||||||||| ||||||||| ||| |||||||||||||||||| |
|
|
T |
22607221 |
ggtgtccggggctcgaaccccggaccttacatatattatgcatt |
22607178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 150 - 225
Target Start/End: Original strand, 41187449 - 41187524
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
|||| |||||||||||||||| |||||| ||||| ||||||||||| |||||||| | ||||||| | |||||| |
|
|
T |
41187449 |
ggtgaccggggttcgaaccccggactttgcatattttatgcattgtccataccaactaagctaagctcacgaggac |
41187524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 150 - 197
Target Start/End: Complemental strand, 41853434 - 41853387
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgttt |
197 |
Q |
|
|
|||| ||||||||||||| || ||| |||||||||||||||||||||| |
|
|
T |
41853434 |
ggtggccggggttcgaacgccggaccttacatatattatgcattgttt |
41853387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 150 - 216
Target Start/End: Original strand, 2434902 - 2434968
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagct |
216 |
Q |
|
|
|||||||||| |||||||| ||||| || |||||||||||||||| | |||||||||||||||| |
|
|
T |
2434902 |
ggtgtccgggattcgaacctcagaccttcaatatattatgcattgtccttcccaactgaactaagct |
2434968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 150 - 216
Target Start/End: Original strand, 2687367 - 2687432
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagct |
216 |
Q |
|
|
||||||| |||||||||||| | ||||| ||||||| |||||||||| |||||||||| ||||||| |
|
|
T |
2687367 |
ggtgtccagggttcgaacccga-actttgcatatataatgcattgttcttaccaactgagctaagct |
2687432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 179 - 225
Target Start/End: Complemental strand, 7206165 - 7206119
Alignment:
Q |
179 |
catatattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
||||||||||||||||| |||||||||||| ||||||| | |||||| |
|
|
T |
7206165 |
catatattatgcattgtctctaccaactgagctaagctcacgaggac |
7206119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 164 - 218
Target Start/End: Complemental strand, 7350601 - 7350547
Alignment:
Q |
164 |
gaaccccagactttacatatattatgcattgtttctaccaactgaactaagctta |
218 |
Q |
|
|
|||||| ||||||| ||||||||||||||||| |||||||||| ||||||||| |
|
|
T |
7350601 |
gaaccctagactttgcatatattatgcattgtccataccaactgagctaagctta |
7350547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 151 - 225
Target Start/End: Original strand, 8788287 - 8788361
Alignment:
Q |
151 |
gtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
||||| |||||||||||| | | |||||||||||||| |||||| ||| ||||||| ||||||||| |||||| |
|
|
T |
8788287 |
gtgtctggggttcgaaccttaaatcttacatatattatgtattgttcctatcaactgacctaagcttacgaggac |
8788361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 150 - 216
Target Start/End: Original strand, 24520631 - 24520697
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagct |
216 |
Q |
|
|
|||||| ||||||||| |||||||| | ||||||||||||||||| | |||||||| | ||||||| |
|
|
T |
24520631 |
ggtgtctggggttcgagccccagaccatgcatatattatgcattgtctttaccaactaagctaagct |
24520697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 158 - 216
Target Start/End: Complemental strand, 24593437 - 24593379
Alignment:
Q |
158 |
gggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagct |
216 |
Q |
|
|
||||||||||||| ||| || ||||||||||||||||| |||||||||| ||||||| |
|
|
T |
24593437 |
gggttcgaaccccggaccttgcatatattatgcattgtccttaccaactgagctaagct |
24593379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 150 - 216
Target Start/End: Complemental strand, 29544696 - 29544630
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagct |
216 |
Q |
|
|
|||| |||||||| ||||||| ||| || ||||||||||||||||| ||||||| ||| ||||||| |
|
|
T |
29544696 |
ggtggccggggtttgaaccccggaccttgcatatattatgcattgtccctaccaattgagctaagct |
29544630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 150 - 216
Target Start/End: Original strand, 32190000 - 32190066
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagct |
216 |
Q |
|
|
||||||||||||||||||||| | | | |||| |||||||| ||| ||||||||||||||||||| |
|
|
T |
32190000 |
ggtgtccggggttcgaaccccggcccctgcataaattatgcaatgtccctaccaactgaactaagct |
32190066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 179 - 225
Target Start/End: Complemental strand, 37984395 - 37984349
Alignment:
Q |
179 |
catatattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
||||||||||||||||||| |||||||||| ||||| ||| |||||| |
|
|
T |
37984395 |
catatattatgcattgtttataccaactgagctaagtttacgaggac |
37984349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 158 - 195
Target Start/End: Complemental strand, 3904263 - 3904226
Alignment:
Q |
158 |
gggttcgaaccccagactttacatatattatgcattgt |
195 |
Q |
|
|
||||| ||||||||||| |||||||||||||||||||| |
|
|
T |
3904263 |
gggtttgaaccccagaccttacatatattatgcattgt |
3904226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 155 - 216
Target Start/End: Original strand, 15407518 - 15407579
Alignment:
Q |
155 |
ccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagct |
216 |
Q |
|
|
|||||||| |||||||| || || |||||||||||||||||| |||||| || | ||||||| |
|
|
T |
15407518 |
ccggggtttgaaccccaaacatttcatatattatgcattgttcctaccagctaagctaagct |
15407579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 156 - 225
Target Start/End: Complemental strand, 24033800 - 24033731
Alignment:
Q |
156 |
cggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
|||||||||||| || ||||| ||||| ||||||||||| ||||||||| || ||||||| | |||||| |
|
|
T |
24033800 |
cggggttcgaacttcacactttgcatattttatgcattgtctctaccaaccgagctaagctcacgaggac |
24033731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 156 - 225
Target Start/End: Original strand, 29133482 - 29133551
Alignment:
Q |
156 |
cggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
|||||||||||||| ||| || ||||| |||||||||||| |||||||||| |||| |||| |||||| |
|
|
T |
29133482 |
cggggttcgaaccctagatcttgcatattttatgcattgttcataccaactgagctaaacttacgaggac |
29133551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 161 - 214
Target Start/End: Complemental strand, 31156871 - 31156818
Alignment:
Q |
161 |
ttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaag |
214 |
Q |
|
|
||||||||||||| |||||||||||||||||| | ||||||||||| ||||| |
|
|
T |
31156871 |
ttcgaaccccagatcttacatatattatgcattatccctaccaactgagctaag |
31156818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 176 - 213
Target Start/End: Original strand, 41672302 - 41672339
Alignment:
Q |
176 |
ttacatatattatgcattgtttctaccaactgaactaa |
213 |
Q |
|
|
|||||||| ||||||||||||| ||||||||||||||| |
|
|
T |
41672302 |
ttacatattttatgcattgtttataccaactgaactaa |
41672339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 176 - 216
Target Start/End: Complemental strand, 2429059 - 2429019
Alignment:
Q |
176 |
ttacatatattatgcattgtttctaccaactgaactaagct |
216 |
Q |
|
|
|||||||||||||||||||| |||||||||||||||||| |
|
|
T |
2429059 |
ttacatatattatgcattgtccttaccaactgaactaagct |
2429019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 152 - 188
Target Start/End: Original strand, 2939777 - 2939813
Alignment:
Q |
152 |
tgtccggggttcgaaccccagactttacatatattat |
188 |
Q |
|
|
||||||||||||||||||||||| || |||||||||| |
|
|
T |
2939777 |
tgtccggggttcgaaccccagaccttgcatatattat |
2939813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 155 - 195
Target Start/End: Complemental strand, 5028920 - 5028880
Alignment:
Q |
155 |
ccggggttcgaaccccagactttacatatattatgcattgt |
195 |
Q |
|
|
|||||||| |||||||| || |||||||||||||||||||| |
|
|
T |
5028920 |
ccggggtttgaaccccaaaccttacatatattatgcattgt |
5028880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 161 - 225
Target Start/End: Original strand, 9842205 - 9842269
Alignment:
Q |
161 |
ttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
||||||||||| || || ||||| ||||||||||| ||||||||||| ||||||| | |||||| |
|
|
T |
9842205 |
ttcgaaccccaaaccttgcatattttatgcattgtccctaccaactgagctaagctcacgaggac |
9842269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 152 - 204
Target Start/End: Complemental strand, 10058938 - 10058886
Alignment:
Q |
152 |
tgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaa |
204 |
Q |
|
|
|||||||||||| |||||| |||| ||||||||||||||||| |||||||| |
|
|
T |
10058938 |
tgtccggggttcaaaccccgacctttgcatatattatgcattgtctctaccaa |
10058886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 150 - 225
Target Start/End: Original strand, 19595470 - 19595546
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacata-tattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
|||| |||||||||||||||||||| || |||| |||||||||| ||| |||||||||| ||| || |||||||| |
|
|
T |
19595470 |
ggtggccggggttcgaaccccagaccttgcatattattatgcatggttcataccaactgagttaaactcatgaggac |
19595546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 20517080 - 20517028
Alignment:
Q |
161 |
ttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaa |
213 |
Q |
|
|
|||||| |||||| ||||||||||||||||||||| |||||||||| |||| |
|
|
T |
20517080 |
ttcgaatcccagaacttacatatattatgcattgttcttaccaactgagctaa |
20517028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 156 - 208
Target Start/End: Original strand, 31815885 - 31815937
Alignment:
Q |
156 |
cggggttcgaaccccagactttacatatattatgcattgtttctaccaactga |
208 |
Q |
|
|
||||||| ||||||| ||| || ||||||||||||||||| ||||||||||| |
|
|
T |
31815885 |
cggggtttgaaccccggaccttgcatatattatgcattgtccctaccaactga |
31815937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 164 - 208
Target Start/End: Complemental strand, 31835546 - 31835502
Alignment:
Q |
164 |
gaaccccagactttacatatattatgcattgtttctaccaactga |
208 |
Q |
|
|
|||||||||||||| ||||| |||||||||||| |||||||||| |
|
|
T |
31835546 |
gaaccccagactttgcatatgttatgcattgttcttaccaactga |
31835502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 160 - 208
Target Start/End: Complemental strand, 35727496 - 35727448
Alignment:
Q |
160 |
gttcgaaccccagactttacatatattatgcattgtttctaccaactga |
208 |
Q |
|
|
|||||||||||| || || |||||||||||||||||| |||||||||| |
|
|
T |
35727496 |
gttcgaaccccaaaccttgcatatattatgcattgttcttaccaactga |
35727448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0019 (Bit Score: 135; Significance: 3e-70; HSPs: 1)
Name: scaffold0019
Description:
Target: scaffold0019; HSP #1
Raw Score: 135; E-Value: 3e-70
Query Start/End: Original strand, 7 - 196
Target Start/End: Complemental strand, 48859 - 48670
Alignment:
Q |
7 |
aatatcaagcaaaggtttccaaaaactcagtctgtgagcatctccccaaatagagagacccatatacaagaacgtaacccgccccatgttgcatcttaac |
106 |
Q |
|
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||| |
|
|
T |
48859 |
aatatcaagcaaaggtttccaaaaactcagtctatgagcatctccccaaatagagagacccatatacaagaacgtaacccgccccatgttacatctcaac |
48760 |
T |
 |
Q |
107 |
atagaagcgccctaaatttattaagtggtatcaannnnnnnnnggtgtccggggttcgaaccccagactttacatatattatgcattgtt |
196 |
Q |
|
|
|||||||||||||||||||||||||||||||||| ||||||||||||| ||| ||| |||||| |||||||||||||||||| |
|
|
T |
48759 |
atagaagcgccctaaatttattaagtggtatcaattttttgttggtgtccggggtttgaatcccggactttgcatatattatgcattgtt |
48670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 49; Significance: 7e-19; HSPs: 75)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 157 - 213
Target Start/End: Original strand, 5182644 - 5182700
Alignment:
Q |
157 |
ggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaa |
213 |
Q |
|
|
||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||| |
|
|
T |
5182644 |
ggggttcgaaccctagactttacatatattatgtattgtttctaccaactgaactaa |
5182700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 150 - 203
Target Start/End: Original strand, 7996681 - 7996734
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctacca |
203 |
Q |
|
|
|||||||| |||| ||||| || ||||||||||||||||||||||||||||||| |
|
|
T |
7996681 |
ggtgtccgaggtttgaacctcaaactttacatatattatgcattgtttctacca |
7996734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 152 - 208
Target Start/End: Original strand, 9398407 - 9398463
Alignment:
Q |
152 |
tgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactga |
208 |
Q |
|
|
|||| |||||||||||||||||| |||||||||| |||||||||| |||||||||| |
|
|
T |
9398407 |
tgtctggggttcgaaccccagaccttacatatatcatgcattgttcttaccaactga |
9398463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 153 - 213
Target Start/End: Complemental strand, 9413864 - 9413804
Alignment:
Q |
153 |
gtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaa |
213 |
Q |
|
|
||||||| |||||||||| || ||||||||||||||||||||| ||||||||||||||| |
|
|
T |
9413864 |
gtccgggattcgaaccccgaaccttacatatattatgcattgttcttaccaactgaactaa |
9413804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 156 - 216
Target Start/End: Complemental strand, 13401660 - 13401600
Alignment:
Q |
156 |
cggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagct |
216 |
Q |
|
|
||||||| ||||||| || |||||||||||||||||||| |||| ||||||||||||||| |
|
|
T |
13401660 |
cggggtttgaaccccgaaccttacatatattatgcattgtctctatcaactgaactaagct |
13401600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 156 - 215
Target Start/End: Complemental strand, 18166665 - 18166606
Alignment:
Q |
156 |
cggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagc |
215 |
Q |
|
|
||||||| ||||||| |||||| ||||||||||||||||| | |||||||||| |||||| |
|
|
T |
18166665 |
cggggtttgaaccccggactttgcatatattatgcattgtctataccaactgagctaagc |
18166606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 158 - 225
Target Start/End: Original strand, 21400023 - 21400090
Alignment:
Q |
158 |
gggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
|||||||||||| |||| || ||||||||||||||||| ||||||||||| ||||||| | |||||| |
|
|
T |
21400023 |
gggttcgaacccaagaccttgcatatattatgcattgtccctaccaactgagctaagctcacgaggac |
21400090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 161 - 208
Target Start/End: Original strand, 28455356 - 28455403
Alignment:
Q |
161 |
ttcgaaccccagactttacatatattatgcattgtttctaccaactga |
208 |
Q |
|
|
||||||||||| ||||| ||||||||||||||||| |||||||||||| |
|
|
T |
28455356 |
ttcgaaccccaaactttgcatatattatgcattgtctctaccaactga |
28455403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 150 - 225
Target Start/End: Original strand, 37045138 - 37045213
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
|||||| ||||||||||||| ||| || |||||||||||||||||| ||||||||||| || |||| | |||||| |
|
|
T |
37045138 |
ggtgtctggggttcgaaccctggaccttgcatatattatgcattgttcctaccaactgagctgagctcacgaggac |
37045213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 150 - 216
Target Start/End: Complemental strand, 14521013 - 14520947
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagct |
216 |
Q |
|
|
|||| ||||||||||||||||| ||||| ||||| ||||||||||| |||||||||| ||||||| |
|
|
T |
14521013 |
ggtggccggggttcgaaccccaaactttgcatattttatgcattgtccataccaactgagctaagct |
14520947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 155 - 225
Target Start/End: Complemental strand, 25533037 - 25532967
Alignment:
Q |
155 |
ccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
|||||||| ||||||| ||| || ||||||||||||||||| |||||||||||||||||| | |||||| |
|
|
T |
25533037 |
ccggggtttgaaccccggaccttgcatatattatgcattgtccataccaactgaactaagctcacgaggac |
25532967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 150 - 196
Target Start/End: Original strand, 29798108 - 29798154
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtt |
196 |
Q |
|
|
|||||| || ||||||||||||||| ||||||||||||||||||||| |
|
|
T |
29798108 |
ggtgtctggtgttcgaaccccagaccttacatatattatgcattgtt |
29798154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 32864349 - 32864303
Alignment:
Q |
162 |
tcgaaccccagactttacatatattatgcattgtttctaccaactga |
208 |
Q |
|
|
||||||||| |||||| ||||||||||||||||| |||||||||||| |
|
|
T |
32864349 |
tcgaaccccggactttgcatatattatgcattgtctctaccaactga |
32864303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 167 - 225
Target Start/End: Original strand, 36371049 - 36371107
Alignment:
Q |
167 |
ccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
|||| ||| |||||||||||||||||||| |||||||||||| ||||||| | |||||| |
|
|
T |
36371049 |
ccccggaccttacatatattatgcattgtctctaccaactgagctaagctcacgaggac |
36371107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 150 - 216
Target Start/End: Original strand, 38448858 - 38448924
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagct |
216 |
Q |
|
|
|||||||||| |||||||||| ||| || ||||||||||||||||| |||||||||| ||||||| |
|
|
T |
38448858 |
ggtgtccgggattcgaaccccggaccttgcatatattatgcattgtccttaccaactgagctaagct |
38448924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 180 - 225
Target Start/End: Original strand, 5503787 - 5503832
Alignment:
Q |
180 |
atatattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
|||| |||||||||||||||||||||||| ||||||||| |||||| |
|
|
T |
5503787 |
atattttatgcattgtttctaccaactgagctaagcttacgaggac |
5503832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 159 - 216
Target Start/End: Complemental strand, 21016022 - 21015965
Alignment:
Q |
159 |
ggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagct |
216 |
Q |
|
|
|||||||||||| || ||||||||||||||||||||| |||||||||| ||||||| |
|
|
T |
21016022 |
ggttcgaaccccgaaccttacatatattatgcattgttcttaccaactgagctaagct |
21015965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 157 - 226
Target Start/End: Original strand, 29233973 - 29234042
Alignment:
Q |
157 |
ggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgaggacg |
226 |
Q |
|
|
|||||||||||||||||| || ||||| ||||||||||| | |||||||||| |||| || | ||||||| |
|
|
T |
29233973 |
ggggttcgaaccccagaccttgcatattttatgcattgtctataccaactgagctaaactcacgaggacg |
29234042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 157 - 222
Target Start/End: Complemental strand, 34083399 - 34083334
Alignment:
Q |
157 |
ggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgag |
222 |
Q |
|
|
||||||||||||||| || ||||||||||||||||||||| ||||| |||| |||||| ||||| |
|
|
T |
34083399 |
ggggttcgaaccccaaaccttacatatattatgcattgttcttaccatctgagttaagctcatgag |
34083334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 164 - 225
Target Start/End: Complemental strand, 35308240 - 35308179
Alignment:
Q |
164 |
gaaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
|||||||||| ||| ||||||||||||||||| |||||||||||||||||| | |||||| |
|
|
T |
35308240 |
gaaccccagattttgtatatattatgcattgttcataccaactgaactaagctcacgaggac |
35308179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 156 - 225
Target Start/End: Complemental strand, 43356498 - 43356430
Alignment:
Q |
156 |
cggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
||||||| |||| ||| || ||||||||||||||||||| | ||||||||||||||||| | |||||||| |
|
|
T |
43356498 |
cggggtttgaactccaaaccttacatatattatgcattg-tcctaccaactgaactaagttcatgaggac |
43356430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 150 - 225
Target Start/End: Complemental strand, 3481630 - 3481554
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgca-ttgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
|||| |||||||| ||||||||||| || ||||||||||||| |||| ||||||||||| ||||||| | |||||| |
|
|
T |
3481630 |
ggtggccggggtttgaaccccagaccttgcatatattatgcatttgtccctaccaactgagctaagctcacgaggac |
3481554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 156 - 208
Target Start/End: Complemental strand, 5280694 - 5280642
Alignment:
Q |
156 |
cggggttcgaaccccagactttacatatattatgcattgtttctaccaactga |
208 |
Q |
|
|
||||||||||||||||||| || ||||||||||||| ||| ||| |||||||| |
|
|
T |
5280694 |
cggggttcgaaccccagaccttgcatatattatgcactgtctcttccaactga |
5280642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 150 - 214
Target Start/End: Original strand, 10132436 - 10132500
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaag |
214 |
Q |
|
|
||||||| |||||||||||||||| || ||||||||||||||||| |||||||||| ||||| |
|
|
T |
10132436 |
ggtgtccaaggttcgaaccccagaccttgcatatattatgcattgtccttaccaactgatctaag |
10132500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 151 - 195
Target Start/End: Complemental strand, 11681291 - 11681247
Alignment:
Q |
151 |
gtgtccggggttcgaaccccagactttacatatattatgcattgt |
195 |
Q |
|
|
|||||||||||| ||||||||||| || ||||||||||||||||| |
|
|
T |
11681291 |
gtgtccggggtttgaaccccagaccttgcatatattatgcattgt |
11681247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 156 - 208
Target Start/End: Original strand, 12268982 - 12269034
Alignment:
Q |
156 |
cggggttcgaaccccagactttacatatattatgcattgtttctaccaactga |
208 |
Q |
|
|
||||||| ||||||| ||| || |||||||||||||||||| ||||||||||| |
|
|
T |
12268982 |
cggggtttgaaccccggaccttgcatatattatgcattgttcctaccaactga |
12269034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 150 - 225
Target Start/End: Original strand, 24752639 - 24752715
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacata-tattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
|||| |||||||||||||||||||| || |||| ||||||||||||| |||||||||| ||||||| | |||||| |
|
|
T |
24752639 |
ggtggccggggttcgaaccccagaccttgcatattattatgcattgtccataccaactgagctaagctcacgaggac |
24752715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 176 - 216
Target Start/End: Original strand, 32826723 - 32826763
Alignment:
Q |
176 |
ttacatatattatgcattgtttctaccaactgaactaagct |
216 |
Q |
|
|
|||||||||||||||||| ||| |||||||||||||||||| |
|
|
T |
32826723 |
ttacatatattatgcattatttttaccaactgaactaagct |
32826763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 156 - 216
Target Start/End: Complemental strand, 32944799 - 32944739
Alignment:
Q |
156 |
cggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagct |
216 |
Q |
|
|
||||||||||||||||||| || ||||||||||||||||| |||||||| | ||||||| |
|
|
T |
32944799 |
cggggttcgaaccccagacgttgcatatattatgcattgtccataccaactaagctaagct |
32944739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 150 - 214
Target Start/End: Original strand, 49431985 - 49432049
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaag |
214 |
Q |
|
|
|||| |||||||| ||||||| ||| |||||||||||||||||| || |||||||| || ||||| |
|
|
T |
49431985 |
ggtggccggggtttgaaccccggaccttacatatattatgcattattcctaccaaccgagctaag |
49432049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 156 - 195
Target Start/End: Complemental strand, 31962510 - 31962471
Alignment:
Q |
156 |
cggggttcgaaccccagactttacatatattatgcattgt |
195 |
Q |
|
|
|||| ||||||||| ||||||||||||||||||||||||| |
|
|
T |
31962510 |
cgggattcgaaccctagactttacatatattatgcattgt |
31962471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 150 - 224
Target Start/End: Original strand, 41916550 - 41916625
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatat-tatgcattgtttctaccaactgaactaagcttatgagga |
224 |
Q |
|
|
|||||||||||||||||||| ||||| ||||||| |||||||||| ||| ||||||| ||||||| ||||||| |
|
|
T |
41916550 |
ggtgtccggggttcgaaccctgaactttgcatatatgtatgcattgtccctatcaactgagctaagctcatgagga |
41916625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 150 - 225
Target Start/End: Original strand, 42045364 - 42045439
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
|||| |||||||| |||| |||||| || ||||||||||||||||| |||||||||| ||||||| | |||||| |
|
|
T |
42045364 |
ggtggccggggtttgaactccagaccttgcatatattatgcattgtccataccaactgagctaagctcacgaggac |
42045439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 150 - 225
Target Start/End: Original strand, 52441503 - 52441578
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
|||| ||||||||| ||| || ||| || ||||||||||||||||| | |||||||||| ||||||| | |||||| |
|
|
T |
52441503 |
ggtggccggggttcaaacgccggaccttgcatatattatgcattgtctataccaactgagctaagctcacgaggac |
52441578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 150 - 204
Target Start/End: Original strand, 3136680 - 3136734
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaa |
204 |
Q |
|
|
||||||||| ||||||||| |||| |||||||||||||||||||| | |||||| |
|
|
T |
3136680 |
ggtgtccggaattcgaaccctagaccttacatatattatgcattgtctttaccaa |
3136734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 179 - 225
Target Start/End: Complemental strand, 7925404 - 7925358
Alignment:
Q |
179 |
catatattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
||||||||||||||||| |||||||||||| ||||||| | |||||| |
|
|
T |
7925404 |
catatattatgcattgtctctaccaactgagctaagctcacgaggac |
7925358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 156 - 226
Target Start/End: Original strand, 12364103 - 12364173
Alignment:
Q |
156 |
cggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgaggacg |
226 |
Q |
|
|
|||||||||||||||||||||| ||||| ||||||| || |||||||||| ||||||| | ||||||| |
|
|
T |
12364103 |
cggggttcgaaccccagactttgcatattttatgcaaggtccataccaactgagctaagctcacgaggacg |
12364173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 150 - 216
Target Start/End: Complemental strand, 17284020 - 17283954
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagct |
216 |
Q |
|
|
||||||| |||||||||||| ||| || ||||||||||||||||| |||||||||| ||||||| |
|
|
T |
17284020 |
ggtgtccagggttcgaaccctggaccttgcatatattatgcattgtccttaccaactgagctaagct |
17283954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 150 - 216
Target Start/End: Complemental strand, 21638182 - 21638116
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagct |
216 |
Q |
|
|
||||||||||||||||||||| ||| || ||||||| ||||||||| |||||| ||| ||||||| |
|
|
T |
21638182 |
ggtgtccggggttcgaaccccggaccttgcatatatcatgcattgtccgtaccaattgagctaagct |
21638116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 156 - 226
Target Start/End: Complemental strand, 27533306 - 27533236
Alignment:
Q |
156 |
cggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgaggacg |
226 |
Q |
|
|
||||||| ||||||| || || ||||||||||||||||| ||||||||||| ||||||| | ||||||| |
|
|
T |
27533306 |
cggggtttgaaccccgaaccttgcatatattatgcattgtccctaccaactgatctaagctcacgaggacg |
27533236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 158 - 208
Target Start/End: Original strand, 32497481 - 32497531
Alignment:
Q |
158 |
gggttcgaaccccagactttacatatattatgcattgtttctaccaactga |
208 |
Q |
|
|
||||| |||||| |||| || |||||||||||||||||| ||||||||||| |
|
|
T |
32497481 |
gggtttgaaccctagaccttgcatatattatgcattgttcctaccaactga |
32497531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 150 - 208
Target Start/End: Original strand, 33153872 - 33153930
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactga |
208 |
Q |
|
|
||||| ||||||| ||||| | ||| |||||||||||||||||||| ||||||||||| |
|
|
T |
33153872 |
ggtgttcggggtttgaacctcggaccttacatatattatgcattgtccctaccaactga |
33153930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 154 - 208
Target Start/End: Original strand, 35337119 - 35337173
Alignment:
Q |
154 |
tccggggttcgaaccccagactttacatatattatgcattgtttctaccaactga |
208 |
Q |
|
|
||||||||||||||| ||||| ||| |||||||||||||| | | |||||||||| |
|
|
T |
35337119 |
tccggggttcgaaccgcagaccttatatatattatgcattatctataccaactga |
35337173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 152 - 206
Target Start/End: Original strand, 41019691 - 41019745
Alignment:
Q |
152 |
tgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaact |
206 |
Q |
|
|
|||| |||| ||||||| |||||||| |||||||||||||||||| |||| |||| |
|
|
T |
41019691 |
tgtcaggggctcgaacctcagactttgcatatattatgcattgttcctacaaact |
41019745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 150 - 204
Target Start/End: Complemental strand, 41973324 - 41973270
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaa |
204 |
Q |
|
|
|||| |||||||||||||||| ||| || ||||||||||||||||| ||||||| |
|
|
T |
41973324 |
ggtggccggggttcgaaccccggaccttgcatatattatgcattgtccctaccaa |
41973270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 179 - 225
Target Start/End: Original strand, 44678038 - 44678084
Alignment:
Q |
179 |
catatattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
||||||||||||||||| | ||| |||||| |||||||||||||||| |
|
|
T |
44678038 |
catatattatgcattgtctatacaaactgagctaagcttatgaggac |
44678084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 150 - 216
Target Start/End: Original strand, 47528439 - 47528505
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagct |
216 |
Q |
|
|
||||||||||||||||||| | ||| || | ||||||||||||||| |||||||||| ||||||| |
|
|
T |
47528439 |
ggtgtccggggttcgaacctcggaccttgcgtatattatgcattgtccttaccaactgagctaagct |
47528505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 156 - 229
Target Start/End: Complemental strand, 2613785 - 2613712
Alignment:
Q |
156 |
cggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgaggacgaaa |
229 |
Q |
|
|
||||||||||||||| || |||||||| ||||||||||| |||||||||| ||||||| | ||||| |||| |
|
|
T |
2613785 |
cggggttcgaaccccgaaccttacatattttatgcattgtccataccaactgagctaagctcacgaggatgaaa |
2613712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 156 - 225
Target Start/End: Original strand, 3693794 - 3693863
Alignment:
Q |
156 |
cggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
||||||| ||||| ||||| ||||||||||||||| |||| | || ||||||| ||||||| | |||||| |
|
|
T |
3693794 |
cggggtttgaacctcagaccttacatatattatgctttgtctatatcaactgagctaagctcacgaggac |
3693863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 157 - 214
Target Start/End: Original strand, 11462921 - 11462978
Alignment:
Q |
157 |
ggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaag |
214 |
Q |
|
|
|||||||||||||| ||| || ||||| ||||||||||| |||| |||| |||||||| |
|
|
T |
11462921 |
ggggttcgaaccccggaccttgcatattttatgcattgtctctagcaaccgaactaag |
11462978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 156 - 225
Target Start/End: Original strand, 17139515 - 17139584
Alignment:
Q |
156 |
cggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
||||||| ||||||| ||| || |||||||||||||||| ||||||||||| ||||||| | |||||| |
|
|
T |
17139515 |
cggggtttgaaccccggaccttgaatatattatgcattgtccctaccaactgagctaagctcacgaggac |
17139584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 176 - 213
Target Start/End: Original strand, 25271781 - 25271818
Alignment:
Q |
176 |
ttacatatattatgcattgtttctaccaactgaactaa |
213 |
Q |
|
|
||||||||||||||||||||| ||||||||||||||| |
|
|
T |
25271781 |
ttacatatattatgcattgttcttaccaactgaactaa |
25271818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 159 - 196
Target Start/End: Original strand, 25524217 - 25524254
Alignment:
Q |
159 |
ggttcgaaccccagactttacatatattatgcattgtt |
196 |
Q |
|
|
||||||||||||| |||||| ||||||||||||||||| |
|
|
T |
25524217 |
ggttcgaaccccaaactttatatatattatgcattgtt |
25524254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 157 - 214
Target Start/End: Original strand, 26803450 - 26803507
Alignment:
Q |
157 |
ggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaag |
214 |
Q |
|
|
|||||| ||||||| |||||| ||||||||||||||||| |||||||||| ||||| |
|
|
T |
26803450 |
ggggtttgaaccccggactttgcatatattatgcattgtccataccaactgagctaag |
26803507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 180 - 213
Target Start/End: Original strand, 26861146 - 26861179
Alignment:
Q |
180 |
atatattatgcattgtttctaccaactgaactaa |
213 |
Q |
|
|
|||||||||||||||| ||||||||||||||||| |
|
|
T |
26861146 |
atatattatgcattgtctctaccaactgaactaa |
26861179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 155 - 208
Target Start/End: Complemental strand, 28031329 - 28031277
Alignment:
Q |
155 |
ccggggttcgaaccccagactttacatatattatgcattgtttctaccaactga |
208 |
Q |
|
|
||||||||||||||| |||||||| |||| ||||||||| | |||||||||||| |
|
|
T |
28031329 |
ccggggttcgaaccc-agactttatatattttatgcattatctctaccaactga |
28031277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 185 - 222
Target Start/End: Original strand, 28055560 - 28055597
Alignment:
Q |
185 |
ttatgcattgtttctaccaactgaactaagcttatgag |
222 |
Q |
|
|
||||||||||||| |||||||||||||||||| ||||| |
|
|
T |
28055560 |
ttatgcattgtttataccaactgaactaagctcatgag |
28055597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 150 - 195
Target Start/End: Complemental strand, 30937544 - 30937499
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgt |
195 |
Q |
|
|
||||||||| ||||||||||||||| || |||||||||| |||||| |
|
|
T |
30937544 |
ggtgtccggagttcgaaccccagaccttgcatatattatacattgt |
30937499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 170 - 207
Target Start/End: Original strand, 39251223 - 39251260
Alignment:
Q |
170 |
cagactttacatatattatgcattgtttctaccaactg |
207 |
Q |
|
|
||||||||||||||||||||| ||||| |||||||||| |
|
|
T |
39251223 |
cagactttacatatattatgcgttgttcctaccaactg |
39251260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 156 - 217
Target Start/End: Complemental strand, 39949875 - 39949814
Alignment:
Q |
156 |
cggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagctt |
217 |
Q |
|
|
|||| |||||||||||||| || ||||||||||||||||| |||||||||| ||||||| |
|
|
T |
39949875 |
cgggattcgaaccccagaccttgtatatattatgcattgttcttaccaactgagttaagctt |
39949814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 156 - 225
Target Start/End: Complemental strand, 40227892 - 40227823
Alignment:
Q |
156 |
cggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
||||||||||||||||||| || |||| ||||||||||| |||||||||| ||||||| || ||||| |
|
|
T |
40227892 |
cggggttcgaaccccagaccttgtatattttatgcattgtccataccaactgagctaagctcataaggac |
40227823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 176 - 213
Target Start/End: Complemental strand, 44243916 - 44243879
Alignment:
Q |
176 |
ttacatatattatgcattgtttctaccaactgaactaa |
213 |
Q |
|
|
||||||||||||||||||||| ||||||||||| |||| |
|
|
T |
44243916 |
ttacatatattatgcattgttcctaccaactgagctaa |
44243879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 180 - 216
Target Start/End: Complemental strand, 14426 - 14390
Alignment:
Q |
180 |
atatattatgcattgtttctaccaactgaactaagct |
216 |
Q |
|
|
|||||||||||||||||| |||||||||| ||||||| |
|
|
T |
14426 |
atatattatgcattgtttataccaactgagctaagct |
14390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 176 - 208
Target Start/End: Original strand, 3573342 - 3573374
Alignment:
Q |
176 |
ttacatatattatgcattgtttctaccaactga |
208 |
Q |
|
|
||||||||||||||||||||| ||||||||||| |
|
|
T |
3573342 |
ttacatatattatgcattgttcctaccaactga |
3573374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 157 - 189
Target Start/End: Complemental strand, 4859145 - 4859113
Alignment:
Q |
157 |
ggggttcgaaccccagactttacatatattatg |
189 |
Q |
|
|
|||||||||||||||||| |||||||||||||| |
|
|
T |
4859145 |
ggggttcgaaccccagaccttacatatattatg |
4859113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 152 - 192
Target Start/End: Original strand, 11354012 - 11354052
Alignment:
Q |
152 |
tgtccggggttcgaaccccagactttacatatattatgcat |
192 |
Q |
|
|
|||||||||||| |||||||||| || |||||||||||||| |
|
|
T |
11354012 |
tgtccggggttcaaaccccagaccttgcatatattatgcat |
11354052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 156 - 208
Target Start/End: Complemental strand, 11410690 - 11410638
Alignment:
Q |
156 |
cggggttcgaaccccagactttacatatattatgcattgtttctaccaactga |
208 |
Q |
|
|
|||| |||||||||||||| |||||||| ||||| |||||| |||||||||| |
|
|
T |
11410690 |
cgggattcgaaccccagaccttacatattttatgtattgttcataccaactga |
11410638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 164 - 216
Target Start/End: Complemental strand, 12214048 - 12213996
Alignment:
Q |
164 |
gaaccccagactttacatatattatgcattgtttctaccaactgaactaagct |
216 |
Q |
|
|
||||||||||| || ||||||||||| |||||| ||| ||||||| ||||||| |
|
|
T |
12214048 |
gaaccccagaccttgcatatattatgtattgttcctatcaactgagctaagct |
12213996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 156 - 216
Target Start/End: Complemental strand, 16307712 - 16307653
Alignment:
Q |
156 |
cggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagct |
216 |
Q |
|
|
||||||| || |||||||| || |||||||||||||||| | |||||| |||||||||||| |
|
|
T |
16307712 |
cggggtttgatccccagaccttgcatatattatgcattg-tcctaccagctgaactaagct |
16307653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 150 - 225
Target Start/End: Complemental strand, 18091273 - 18091197
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatata-ttatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
||||||||||||||||||||| |||||| ||||| ||||||||||| ||| ||||||| |||||| | |||||| |
|
|
T |
18091273 |
ggtgtccggggttcgaaccccggactttgtatatatttatgcattgtccctatcaactgagttaagctcacgaggac |
18091197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 176 - 216
Target Start/End: Original strand, 29741952 - 29741992
Alignment:
Q |
176 |
ttacatatattatgcattgtttctaccaactgaactaagct |
216 |
Q |
|
|
||||||||||||||| |||| |||||||||||| ||||||| |
|
|
T |
29741952 |
ttacatatattatgcgttgtatctaccaactgagctaagct |
29741992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 161 - 193
Target Start/End: Complemental strand, 34485935 - 34485903
Alignment:
Q |
161 |
ttcgaaccccagactttacatatattatgcatt |
193 |
Q |
|
|
|||||||||||||| |||||||||||||||||| |
|
|
T |
34485935 |
ttcgaaccccagaccttacatatattatgcatt |
34485903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 152 - 216
Target Start/End: Complemental strand, 45481560 - 45481496
Alignment:
Q |
152 |
tgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagct |
216 |
Q |
|
|
||||||| ||||||||||| ||| || ||||||||||||||||| |||||| |||| |||||| |
|
|
T |
45481560 |
tgtccggagttcgaaccccggaccttgcatatattatgcattgtccttaccaaatgaattaagct |
45481496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 45701386 - 45701334
Alignment:
Q |
161 |
ttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaa |
213 |
Q |
|
|
||||||| |||||| |||||||| |||||||||||| |||||||||| |||| |
|
|
T |
45701386 |
ttcgaactccagaccttacatattttatgcattgttcataccaactgagctaa |
45701334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 164 - 216
Target Start/End: Complemental strand, 52434646 - 52434594
Alignment:
Q |
164 |
gaaccccagactttacatatattatgcattgtttctaccaactgaactaagct |
216 |
Q |
|
|
||||||||||| || ||||| |||| |||||| ||| |||||||||||||||| |
|
|
T |
52434646 |
gaaccccagaccttgcatattttatacattgtctctgccaactgaactaagct |
52434594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 44; Significance: 6e-16; HSPs: 47)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 150 - 225
Target Start/End: Original strand, 28592679 - 28592754
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
|||||||| |||||||||||||||| |||||||||||||||||||| | | |||| ||||||||||| | |||||| |
|
|
T |
28592679 |
ggtgtccgaggttcgaaccccagaccttacatatattatgcattgtctttgccaattgaactaagctcacgaggac |
28592754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 156 - 225
Target Start/End: Complemental strand, 9111110 - 9111041
Alignment:
Q |
156 |
cggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
||||||||||||||| ||| || |||||||||||||||||| |||||||||||||||||| | |||||| |
|
|
T |
9111110 |
cggggttcgaaccccggaccttgcatatattatgcattgttcataccaactgaactaagctcacgaggac |
9111041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 150 - 225
Target Start/End: Complemental strand, 33975999 - 33975923
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatata-ttatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
||||||||||||||||||||| ||||| ||||||| |||||||||||| ||| ||||||| |||| || |||||||| |
|
|
T |
33975999 |
ggtgtccggggttcgaaccccggacttgacatatatttatgcattgttcctatcaactgagctaaactcatgaggac |
33975923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 150 - 216
Target Start/End: Original strand, 12700413 - 12700479
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagct |
216 |
Q |
|
|
|||| ||||||||| ||||| |||| || |||||||||||||||||| |||||||||||||||||| |
|
|
T |
12700413 |
ggtggccggggttcaaaccctagaccttgcatatattatgcattgttcataccaactgaactaagct |
12700479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 179 - 224
Target Start/End: Complemental strand, 1535343 - 1535298
Alignment:
Q |
179 |
catatattatgcattgtttctaccaactgaactaagcttatgagga |
224 |
Q |
|
|
|||||||||||||||||| ||| ||||||||||||||||||||||| |
|
|
T |
1535343 |
catatattatgcattgttcctatcaactgaactaagcttatgagga |
1535298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 150 - 214
Target Start/End: Complemental strand, 34701216 - 34701152
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaag |
214 |
Q |
|
|
|||| |||| ||| ||||| ||||| || |||||||||||||||||| ||||||||||||||||| |
|
|
T |
34701216 |
ggtggccggagtttgaacctcagaccttgcatatattatgcattgttcctaccaactgaactaag |
34701152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 155 - 216
Target Start/End: Original strand, 655746 - 655807
Alignment:
Q |
155 |
ccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagct |
216 |
Q |
|
|
|||||||||||||||| ||| || ||||||||||||||||| |||||||||| ||||||| |
|
|
T |
655746 |
ccggggttcgaaccccggaccttgcatatattatgcattgtcgataccaactgagctaagct |
655807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 150 - 195
Target Start/End: Original strand, 9333972 - 9334017
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgt |
195 |
Q |
|
|
|||||||| ||||||||||||| || |||||||||||||||||||| |
|
|
T |
9333972 |
ggtgtccgaggttcgaaccccaaaccttacatatattatgcattgt |
9334017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 155 - 216
Target Start/End: Complemental strand, 29069547 - 29069486
Alignment:
Q |
155 |
ccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagct |
216 |
Q |
|
|
|||||||| ||||| |||||||| ||||||||||||||||| ||| ||||||| ||||||| |
|
|
T |
29069547 |
ccggggtttgaacctcagacttttcatatattatgcattgtccctatcaactgagctaagct |
29069486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 150 - 225
Target Start/End: Original strand, 12582534 - 12582610
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatatt-atgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
|||||| ||||||||||| || ||||| |||| |||| |||||||||| ||| |||||||||||| || |||||||| |
|
|
T |
12582534 |
ggtgtctggggttcgaactccggacttgacatgtatttatgcattgttcctatcaactgaactaaactcatgaggac |
12582610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 150 - 214
Target Start/End: Complemental strand, 15062360 - 15062296
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaag |
214 |
Q |
|
|
|||||||| |||||||||||| || |||||||| ||||||||||| |||||||||||||||| |
|
|
T |
15062360 |
ggtgtccgcggttcgaaccccgaaccttacatattttatgcattgtacttaccaactgaactaag |
15062296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 156 - 216
Target Start/End: Complemental strand, 20744201 - 20744141
Alignment:
Q |
156 |
cggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagct |
216 |
Q |
|
|
||||||| ||||||||||| || ||||||||||||||||| |||||||||| ||||||| |
|
|
T |
20744201 |
cggggtttgaaccccagaccttgcatatattatgcattgtccataccaactgagctaagct |
20744141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 150 - 225
Target Start/End: Original strand, 2726409 - 2726484
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
|||| |||||||||||||||| ||| || ||||||||||||||||| |||||||||| |||| ||| |||||| |
|
|
T |
2726409 |
ggtgaccggggttcgaaccccggaccttgcatatattatgcattgtccataccaactgagttaagtttacgaggac |
2726484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 157 - 196
Target Start/End: Complemental strand, 12808931 - 12808892
Alignment:
Q |
157 |
ggggttcgaaccccagactttacatatattatgcattgtt |
196 |
Q |
|
|
|||||||||||||||||| || |||||||||||||||||| |
|
|
T |
12808931 |
ggggttcgaaccccagaccttgcatatattatgcattgtt |
12808892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 150 - 225
Target Start/End: Complemental strand, 16390498 - 16390423
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
|||| ||| |||| ||||||| ||| |||||||||||||||||||| ||||||||||| |||||| | |||||| |
|
|
T |
16390498 |
ggtggccgaggtttgaaccccggaccttacatatattatgcattgtccctaccaactgaggtaagctcacgaggac |
16390423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 150 - 213
Target Start/End: Original strand, 30639418 - 30639481
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaa |
213 |
Q |
|
|
|||||||| | |||||||| ||||| || ||||||||||||||| || ||||||||||| |||| |
|
|
T |
30639418 |
ggtgtccgagattcgaacctcagaccttgcatatattatgcattattcctaccaactgagctaa |
30639481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 176 - 214
Target Start/End: Complemental strand, 4826333 - 4826295
Alignment:
Q |
176 |
ttacatatattatgcattgtttctaccaactgaactaag |
214 |
Q |
|
|
|||||||||||||||||||| |||||||| ||||||||| |
|
|
T |
4826333 |
ttacatatattatgcattgtctctaccaattgaactaag |
4826295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 176 - 214
Target Start/End: Complemental strand, 7730707 - 7730669
Alignment:
Q |
176 |
ttacatatattatgcattgtttctaccaactgaactaag |
214 |
Q |
|
|
||||||| |||||||||||||| |||||||||||||||| |
|
|
T |
7730707 |
ttacatacattatgcattgtttataccaactgaactaag |
7730669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 159 - 213
Target Start/End: Original strand, 8138459 - 8138513
Alignment:
Q |
159 |
ggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaa |
213 |
Q |
|
|
|||| ||||||||||| ||||||||||||||||||||| || ||||||| |||| |
|
|
T |
8138459 |
ggtttgaaccccagaccttacatatattatgcattgttcttatcaactgagctaa |
8138513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 158 - 216
Target Start/End: Original strand, 8637437 - 8637495
Alignment:
Q |
158 |
gggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagct |
216 |
Q |
|
|
||||| ||||| | ||| || ||||||||||||||||| ||||||||||||||||||| |
|
|
T |
8637437 |
gggtttgaacctcggaccttgcatatattatgcattgtccctaccaactgaactaagct |
8637495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 164 - 225
Target Start/End: Original strand, 14036284 - 14036346
Alignment:
Q |
164 |
gaaccccagactttacatat-attatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
|||||||||| ||||||||| ||||||||||||| |||||||||| ||||| ||| |||||| |
|
|
T |
14036284 |
gaaccccagaatttacatattattatgcattgttcataccaactgagctaaggttacgaggac |
14036346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 150 - 216
Target Start/End: Original strand, 17829300 - 17829366
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagct |
216 |
Q |
|
|
||||| ||||||||||||| | |||||| |||||||||||||| || |||||||||| ||||||| |
|
|
T |
17829300 |
ggtgttcggggttcgaacctcggactttgcatatattatgcatagtccttaccaactgagctaagct |
17829366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 150 - 216
Target Start/End: Original strand, 28046170 - 28046236
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagct |
216 |
Q |
|
|
||||| |||||||| |||| || || || ||||||||||||||||| | || ||||||||||||||| |
|
|
T |
28046170 |
ggtgttcggggttcaaacctcaaaccttgcatatattatgcattgtctttatcaactgaactaagct |
28046236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 150 - 216
Target Start/End: Complemental strand, 29431528 - 29431462
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagct |
216 |
Q |
|
|
||||||||||| ||||||| ||||| ||||||| |||||||||||| || ||| ||||||||||| |
|
|
T |
29431528 |
ggtgtccggggatcgaacctcagaccttacatacattatgcattgtccttatcaaatgaactaagct |
29431462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 172 - 206
Target Start/End: Complemental strand, 30345442 - 30345408
Alignment:
Q |
172 |
gactttacatatattatgcattgtttctaccaact |
206 |
Q |
|
|
|||| |||||||||||||||||||||||||||||| |
|
|
T |
30345442 |
gactctacatatattatgcattgtttctaccaact |
30345408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 150 - 195
Target Start/End: Complemental strand, 9973287 - 9973242
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgt |
195 |
Q |
|
|
|||| |||| |||||||||||| || |||||||||||||||||||| |
|
|
T |
9973287 |
ggtggccggagttcgaaccccaaaccttacatatattatgcattgt |
9973242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 156 - 213
Target Start/End: Original strand, 14918298 - 14918355
Alignment:
Q |
156 |
cggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaa |
213 |
Q |
|
|
||||||| ||||||||||| || |||||||||||||||| ||||||||||| |||| |
|
|
T |
14918298 |
cggggtttgaaccccagaccttgtatatattatgcattgtccctaccaactgagctaa |
14918355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 156 - 213
Target Start/End: Original strand, 27080696 - 27080753
Alignment:
Q |
156 |
cggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaa |
213 |
Q |
|
|
||||||| ||| |||||| || ||||||||||||||||| |||| |||||||||||| |
|
|
T |
27080696 |
cggggtttgaatcccagagcttgcatatattatgcattgtctctaacaactgaactaa |
27080753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 150 - 218
Target Start/End: Original strand, 28231144 - 28231213
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatata-ttatgcattgtttctaccaactgaactaagctta |
218 |
Q |
|
|
||||||||||||||||||||| ||||| ||||||| ||||| |||||| ||| || |||| |||| |||| |
|
|
T |
28231144 |
ggtgtccggggttcgaaccccggacttgacatatatttatgaattgttcctatcatctgagctaaactta |
28231213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 176 - 225
Target Start/End: Original strand, 30370168 - 30370217
Alignment:
Q |
176 |
ttacatatattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
|||||||||||||||||| | | |||||||||||||||||| | |||||| |
|
|
T |
30370168 |
ttacatatattatgcattatctttaccaactgaactaagctcacgaggac |
30370217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 179 - 224
Target Start/End: Original strand, 31030643 - 31030688
Alignment:
Q |
179 |
catatattatgcattgtttctaccaactgaactaagcttatgagga |
224 |
Q |
|
|
||||||||||| |||||||||| |||||||| |||||||| ||||| |
|
|
T |
31030643 |
catatattatgtattgtttctatcaactgaagtaagcttacgagga |
31030688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 156 - 225
Target Start/End: Original strand, 34481412 - 34481481
Alignment:
Q |
156 |
cggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
||||||| ||||||| ||| || ||||||| |||||||||| ||| |||||| ||||||||||||||| |
|
|
T |
34481412 |
cggggtttgaaccccggaccttgcatatataatgcattgttcatactaactgagttaagcttatgaggac |
34481481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 164 - 216
Target Start/End: Complemental strand, 334195 - 334143
Alignment:
Q |
164 |
gaaccccagactttacatatattatgcattgtttctaccaactgaactaagct |
216 |
Q |
|
|
||||||||||| || ||||||||||||||||| | || ||||||| ||||||| |
|
|
T |
334195 |
gaaccccagaccttgcatatattatgcattgtctttatcaactgagctaagct |
334143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 150 - 225
Target Start/End: Original strand, 3053991 - 3054067
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatatt-atgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
||||||||| |||||| ||| |||||| ||||||||| |||||||||| ||| ||| ||| ||||||| | |||||| |
|
|
T |
3053991 |
ggtgtccggcgttcgagccctagacttgacatatatttatgcattgttcctatcaattgagctaagctcacgaggac |
3054067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 159 - 187
Target Start/End: Original strand, 6708388 - 6708416
Alignment:
Q |
159 |
ggttcgaaccccagactttacatatatta |
187 |
Q |
|
|
||||||||||||||||||||||||||||| |
|
|
T |
6708388 |
ggttcgaaccccagactttacatatatta |
6708416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 155 - 195
Target Start/End: Complemental strand, 10902404 - 10902364
Alignment:
Q |
155 |
ccggggttcgaaccccagactttacatatattatgcattgt |
195 |
Q |
|
|
|||| |||||||| ||| ||||||||||||||||||||||| |
|
|
T |
10902404 |
ccggagttcgaactccaaactttacatatattatgcattgt |
10902364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 156 - 208
Target Start/End: Original strand, 12232180 - 12232232
Alignment:
Q |
156 |
cggggttcgaaccccagactttacatatattatgcattgtttctaccaactga |
208 |
Q |
|
|
||||||||||||||||||| | ||||||||||||||||| ||| ||||||| |
|
|
T |
12232180 |
cggggttcgaaccccagacactgcatatattatgcattgtccctatcaactga |
12232232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 165 - 225
Target Start/End: Complemental strand, 12256530 - 12256471
Alignment:
Q |
165 |
aaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
||||||||||||||||||| ||||||||| ||| ||||||||| ||||||| | |||||| |
|
|
T |
12256530 |
aaccccagactttacatattttatgcatt-attcaaccaactgagctaagctcacgaggac |
12256471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 150 - 214
Target Start/End: Original strand, 12276223 - 12276287
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaag |
214 |
Q |
|
|
|||||||| | |||||| ||| ||||| |||||||||||||||||| |||||||||| ||||| |
|
|
T |
12276223 |
ggtgtccgagattcgaatcccgaactttgcatatattatgcattgttcttaccaactgagctaag |
12276287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 158 - 206
Target Start/End: Complemental strand, 12412338 - 12412290
Alignment:
Q |
158 |
gggttcgaaccccagactttacatatattatgcattgtttctaccaact |
206 |
Q |
|
|
||||| ||||| ||||| || ||||||||||||||||| |||||||||| |
|
|
T |
12412338 |
gggttagaaccgcagaccttgcatatattatgcattgtctctaccaact |
12412290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 150 - 225
Target Start/End: Original strand, 12841869 - 12841945
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatata-ttatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
||||||||| ||||||||||| ||| ||||||||| ||||||||||| ||| |||| || ||||||| | |||||| |
|
|
T |
12841869 |
ggtgtccggtgttcgaaccccggaccttacatatatttatgcattgtcgctatcaaccgagctaagctcacgaggac |
12841945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 177 - 209
Target Start/End: Complemental strand, 20600583 - 20600551
Alignment:
Q |
177 |
tacatatattatgcattgtttctaccaactgaa |
209 |
Q |
|
|
|||||||||||||||||||||||||||| |||| |
|
|
T |
20600583 |
tacatatattatgcattgtttctaccaattgaa |
20600551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 156 - 224
Target Start/End: Original strand, 22792938 - 22793006
Alignment:
Q |
156 |
cggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgagga |
224 |
Q |
|
|
||||||| ||||||| ||| ||||||||||||| | |||| |||||||||| ||||||||| ||||| |
|
|
T |
22792938 |
cggggtttgaaccccggaccttacatatattattcgttgtccttaccaactgagctaagcttacgagga |
22793006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 158 - 214
Target Start/End: Original strand, 23507391 - 23507447
Alignment:
Q |
158 |
gggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaag |
214 |
Q |
|
|
|||||||||||||| || |||||||| ||||| ||||| |||||||||||||||| |
|
|
T |
23507391 |
gggttcgaaccccaaaccttacatattttatgtattgtccttaccaactgaactaag |
23507447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 150 - 214
Target Start/End: Original strand, 28758282 - 28758346
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaag |
214 |
Q |
|
|
||||| ||||||| ||||| | |||||| |||||||||||||||||| ||||| |||| ||||| |
|
|
T |
28758282 |
ggtgttcggggtttgaacctcggactttgcatatattatgcattgttcttaccagctgagctaag |
28758346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 170 - 218
Target Start/End: Complemental strand, 32149187 - 32149139
Alignment:
Q |
170 |
cagactttacatatattatgcattgtttctaccaactgaactaagctta |
218 |
Q |
|
|
||||| || |||||||||||||||||| |||||||||| ||||||||| |
|
|
T |
32149187 |
cagaccttgcatatattatgcattgttcttaccaactgagctaagctta |
32149139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 150 - 213
Target Start/End: Complemental strand, 34828376 - 34828312
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacata-tattatgcattgtttctaccaactgaactaa |
213 |
Q |
|
|
|||| |||||||||||||| ||||| ||||||| ||||||||||||| |||||||||| |||| |
|
|
T |
34828376 |
ggtggccggggttcgaacctcagaccttacatattattatgcattgtccataccaactgagctaa |
34828312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 44; Significance: 6e-16; HSPs: 53)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 150 - 225
Target Start/End: Complemental strand, 5846098 - 5846023
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
||||||||||||| |||||||||||||| ||||||||||||||||| |||||||||| ||||| |||| ||||| |
|
|
T |
5846098 |
ggtgtccggggtttgaaccccagactttgcatatattatgcattgtccttaccaactgagctaagtttataaggac |
5846023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 150 - 225
Target Start/End: Original strand, 27721667 - 27721742
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
||||||| ||| | |||||||||||||| |||||||||||||||||| ||||||||||| ||||||| | |||||| |
|
|
T |
27721667 |
ggtgtccaggggttgaaccccagactttgcatatattatgcattgttcctaccaactgagctaagctcacgaggac |
27721742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 150 - 226
Target Start/End: Complemental strand, 16089519 - 16089443
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgaggacg |
226 |
Q |
|
|
|||| |||||||||||| ||||||| || || |||||||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
16089519 |
ggtggccggggttcgaatcccagaccttgcaaatattatgcattgtccataccaactgaactaagcttacgaggacg |
16089443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 150 - 225
Target Start/End: Complemental strand, 6489076 - 6489001
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
|||| |||||||| ||||||||||| || ||||||||||||||||| ||||||||||| ||||||| | |||||| |
|
|
T |
6489076 |
ggtggccggggtttgaaccccagaccttgcatatattatgcattgtccctaccaactgagctaagctcacgaggac |
6489001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 150 - 208
Target Start/End: Original strand, 31708138 - 31708196
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactga |
208 |
Q |
|
|
|||||||| |||||||||||||||| || |||||||||||||||||| |||||||||| |
|
|
T |
31708138 |
ggtgtccgaggttcgaaccccagaccttgcatatattatgcattgttcataccaactga |
31708196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 156 - 216
Target Start/End: Complemental strand, 26409316 - 26409256
Alignment:
Q |
156 |
cggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagct |
216 |
Q |
|
|
||||||||||||||| ||| |||||||||||||||||||| |||||||||| ||||||| |
|
|
T |
26409316 |
cggggttcgaaccccggaccttacatatattatgcattgtccataccaactgagctaagct |
26409256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 156 - 227
Target Start/End: Complemental strand, 15889474 - 15889403
Alignment:
Q |
156 |
cggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgaggacga |
227 |
Q |
|
|
||||||| |||||| |||| || ||||||||||||||||| ||||||||||| ||||||| | |||||||| |
|
|
T |
15889474 |
cggggtttgaaccctagaccttgcatatattatgcattgtccctaccaactgagctaagctcacgaggacga |
15889403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 150 - 221
Target Start/End: Complemental strand, 26655533 - 26655462
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatga |
221 |
Q |
|
|
|||| |||||||||||||||| ||| |||||||||||||||||||| |||||||||| || |||| |||| |
|
|
T |
26655533 |
ggtggccggggttcgaaccccggaccttacatatattatgcattgtccataccaactgagctgagctcatga |
26655462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 150 - 221
Target Start/End: Complemental strand, 26927118 - 26927047
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatga |
221 |
Q |
|
|
|||| |||||||||||||||| ||| |||||||||||||||||||| |||||||||| || |||| |||| |
|
|
T |
26927118 |
ggtggccggggttcgaaccccggaccttacatatattatgcattgtccataccaactgagctgagctcatga |
26927047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 150 - 208
Target Start/End: Complemental strand, 1642403 - 1642345
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactga |
208 |
Q |
|
|
|||||| ||||||||||| ||||| || ||||||||||||||||||| |||||||||| |
|
|
T |
1642403 |
ggtgtctggggttcgaactccagatcttgcatatattatgcattgtttttaccaactga |
1642345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 150 - 208
Target Start/End: Original strand, 3416553 - 3416611
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactga |
208 |
Q |
|
|
|||||||||||||||| |||||||| || ||||||||| ||||||||||| ||||||| |
|
|
T |
3416553 |
ggtgtccggggttcgacccccagaccttgtatatattatacattgtttctatcaactga |
3416611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 150 - 216
Target Start/End: Complemental strand, 3955615 - 3955549
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagct |
216 |
Q |
|
|
|||||| ||| |||||||||| || |||||||||||||||||||| | |||||| ||||||||||| |
|
|
T |
3955615 |
ggtgtctgggattcgaaccccgaacattacatatattatgcattgtctttaccaattgaactaagct |
3955549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 179 - 216
Target Start/End: Original strand, 37791184 - 37791221
Alignment:
Q |
179 |
catatattatgcattgtttctaccaactgaactaagct |
216 |
Q |
|
|
|||||||||||| ||||||||||||||||||||||||| |
|
|
T |
37791184 |
catatattatgcgttgtttctaccaactgaactaagct |
37791221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 150 - 214
Target Start/End: Complemental strand, 43354514 - 43354449
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatata-ttatgcattgtttctaccaactgaactaag |
214 |
Q |
|
|
||||||||||||||||||||| |||||| |||||| ||||| ||||| |||| ||||||| ||||| |
|
|
T |
43354514 |
ggtgtccggggttcgaaccccggactttgcatatatttatgtattgtctctatcaactgagctaag |
43354449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 150 - 214
Target Start/End: Original strand, 1669572 - 1669636
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaag |
214 |
Q |
|
|
|||| |||||| | |||||| ||||||| |||||||||||||||||| |||||||||| ||||| |
|
|
T |
1669572 |
ggtgaccggggattgaaccctagactttgcatatattatgcattgttcttaccaactgagctaag |
1669636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 158 - 226
Target Start/End: Original strand, 5551281 - 5551349
Alignment:
Q |
158 |
gggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgaggacg |
226 |
Q |
|
|
||||| |||||||| || || ||||| |||||||||||| | ||||||||| ||||||| ||||||||| |
|
|
T |
5551281 |
gggtttgaaccccaaaccttgcatattttatgcattgttccaaccaactgagctaagctcatgaggacg |
5551349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 165 - 209
Target Start/End: Original strand, 36162896 - 36162940
Alignment:
Q |
165 |
aaccccagactttacatatattatgcattgtttctaccaactgaa |
209 |
Q |
|
|
|||||||||| ||||||||||||||||||||| ||||||||||| |
|
|
T |
36162896 |
aaccccagaccttacatatattatgcattgttcataccaactgaa |
36162940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 150 - 225
Target Start/End: Complemental strand, 6624845 - 6624770
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
|||| |||||||||||||||| ||| || ||||||||||||||||| | |||||||| ||||||| | |||||| |
|
|
T |
6624845 |
ggtggccggggttcgaaccccggaccttgcatatattatgcattgtccatgccaactgagctaagctcacgaggac |
6624770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 150 - 213
Target Start/End: Complemental strand, 11017245 - 11017182
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaa |
213 |
Q |
|
|
|||||||||| |||||||| ||||| || ||||||||||||||| | ||||||||||| |||| |
|
|
T |
11017245 |
ggtgtccgggattcgaacctcagaccttgcatatattatgcattatccctaccaactgagctaa |
11017182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 179 - 214
Target Start/End: Original strand, 13150874 - 13150909
Alignment:
Q |
179 |
catatattatgcattgtttctaccaactgaactaag |
214 |
Q |
|
|
||||||||||||||||||||||||||||||| |||| |
|
|
T |
13150874 |
catatattatgcattgtttctaccaactgaattaag |
13150909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 150 - 213
Target Start/End: Original strand, 28604410 - 28604473
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaa |
213 |
Q |
|
|
|||||||| | |||||||||| ||| |||||| ||||||||||||| | |||||||||| |||| |
|
|
T |
28604410 |
ggtgtccgtgattcgaaccccggaccttacatttattatgcattgtctttaccaactgagctaa |
28604473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 161 - 216
Target Start/End: Original strand, 32675296 - 32675351
Alignment:
Q |
161 |
ttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagct |
216 |
Q |
|
|
||||||||| |||| || |||||||||||||||||| | |||||||||||||||| |
|
|
T |
32675296 |
ttcgaaccctagaccttgcatatattatgcattgttcttgccaactgaactaagct |
32675351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 158 - 225
Target Start/End: Complemental strand, 37932391 - 37932324
Alignment:
Q |
158 |
gggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
||||||||||||| ||| || ||||||||||||||||| |||||||||| ||||||| | |||||| |
|
|
T |
37932391 |
gggttcgaaccccggaccttgcatatattatgcattgtccataccaactgagctaagctcacgaggac |
37932324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 150 - 216
Target Start/End: Complemental strand, 40541165 - 40541098
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttc-taccaactgaactaagct |
216 |
Q |
|
|
|||||| | |||| ||||||| |||||| |||||||||||||||||| | |||||||||| ||||||| |
|
|
T |
40541165 |
ggtgtctgaggttggaaccccggactttgcatatattatgcattgttccttaccaactgagctaagct |
40541098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 159 - 225
Target Start/End: Complemental strand, 5485246 - 5485180
Alignment:
Q |
159 |
ggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
|||| ||||||| ||| || ||||||||||||||||| ||||||||||| ||||||| | |||||| |
|
|
T |
5485246 |
ggttagaaccccggacattgcatatattatgcattgtccctaccaactgagctaagctcacgaggac |
5485180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 180 - 218
Target Start/End: Complemental strand, 11666042 - 11666004
Alignment:
Q |
180 |
atatattatgcattgtttctaccaactgaactaagctta |
218 |
Q |
|
|
|||||||||||||||||||||||||||||| ||| |||| |
|
|
T |
11666042 |
atatattatgcattgtttctaccaactgaattaaactta |
11666004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 152 - 225
Target Start/End: Complemental strand, 13351524 - 13351450
Alignment:
Q |
152 |
tgtccggggttcgaaccccagactttacatatat-tatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
||||||||||||||||||| |||| ||||||| ||||||||||| ||| ||||||| |||| || |||||||| |
|
|
T |
13351524 |
tgtccggggttcgaaccccgaacttggcatatatatatgcattgttcctatcaactgagctaaactcatgaggac |
13351450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 15105114 - 15105160
Alignment:
Q |
162 |
tcgaaccccagactttacatatattatgcattgtttctaccaactga |
208 |
Q |
|
|
|||||||||| || ||| |||||||||||||||||| |||||||||| |
|
|
T |
15105114 |
tcgaaccccaaaccttatatatattatgcattgtttttaccaactga |
15105160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 150 - 208
Target Start/End: Complemental strand, 22499010 - 22498953
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactga |
208 |
Q |
|
|
|||||||||||||||||||| |||| || ||||||||||||||||| |||||||||| |
|
|
T |
22499010 |
ggtgtccggggttcgaaccc-agaccttgcatatattatgcattgtccttaccaactga |
22498953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 150 - 216
Target Start/End: Complemental strand, 32550248 - 32550182
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagct |
216 |
Q |
|
|
||||| ||||||||||||||| | | | |||| |||||||| ||| |||||||||||||||||||| |
|
|
T |
32550248 |
ggtgtacggggttcgaacccctgcccatgcataaattatgcaatgtctctaccaactgaactaagct |
32550182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 150 - 208
Target Start/End: Original strand, 42168937 - 42168995
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactga |
208 |
Q |
|
|
|||||| |||||||||||||||||| || |||||| |||||||||| |||||||||| |
|
|
T |
42168937 |
ggtgtctggggttcgaaccccagaccttgcatatactatgcattgtccttaccaactga |
42168995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 157 - 194
Target Start/End: Original strand, 1257153 - 1257190
Alignment:
Q |
157 |
ggggttcgaaccccagactttacatatattatgcattg |
194 |
Q |
|
|
|||||||||||||||||| |||||||| |||||||||| |
|
|
T |
1257153 |
ggggttcgaaccccagaccttacatattttatgcattg |
1257190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 176 - 225
Target Start/End: Complemental strand, 7056019 - 7055970
Alignment:
Q |
176 |
ttacatatattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
||||||||||||| ||||| |||||||||||||||| ||||||||||| |
|
|
T |
7056019 |
ttacatatattatatattgtcgctaccaactgaactaaacttatgaggac |
7055970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 161 - 225
Target Start/End: Complemental strand, 8839514 - 8839449
Alignment:
Q |
161 |
ttcgaaccccagactttacatat-attatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
||||||||||| || |||||||| |||||||||||| | ||||||||||||| |||| | |||||| |
|
|
T |
8839514 |
ttcgaaccccaaaccttacatattattatgcattgtctataccaactgaacttagctcacgaggac |
8839449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 156 - 225
Target Start/End: Complemental strand, 10199082 - 10199013
Alignment:
Q |
156 |
cggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
|||| ||||||||||| || ||| |||||||||||||||| |||||||||| ||||||| | |||||| |
|
|
T |
10199082 |
cgggattcgaaccccacaccttatatatattatgcattgtccataccaactgagctaagctcacgaggac |
10199013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 156 - 213
Target Start/End: Original strand, 18489074 - 18489131
Alignment:
Q |
156 |
cggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaa |
213 |
Q |
|
|
|||||||| ||| |||||| || ||||||||||||||||| | |||||||||| |||| |
|
|
T |
18489074 |
cggggttcaaactccagaccttgcatatattatgcattgtctataccaactgagctaa |
18489131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 164 - 225
Target Start/End: Complemental strand, 19248534 - 19248473
Alignment:
Q |
164 |
gaaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
|||||||| || || ||||||||||||||||| | |||||||||| ||||||| | |||||| |
|
|
T |
19248534 |
gaaccccaaacattgcatatattatgcattgtctataccaactgagctaagctcacgaggac |
19248473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 150 - 195
Target Start/End: Complemental strand, 20074621 - 20074576
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgt |
195 |
Q |
|
|
||||||||||||||||| | | ||| |||||||||||||||||||| |
|
|
T |
20074621 |
ggtgtccggggttcgaaactcggacattacatatattatgcattgt |
20074576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 150 - 195
Target Start/End: Original strand, 23118043 - 23118088
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgt |
195 |
Q |
|
|
||||||| | |||||||||||| || |||||||||||||||||||| |
|
|
T |
23118043 |
ggtgtccagagttcgaaccccaaaccttacatatattatgcattgt |
23118088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 176 - 225
Target Start/End: Original strand, 24106207 - 24106256
Alignment:
Q |
176 |
ttacatatattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
|||||||||||||||||||||||| ||| ||||||||| ||| |||||| |
|
|
T |
24106207 |
ttacatatattatgcattgtttctgtcaattgaactaagtttacgaggac |
24106256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 150 - 195
Target Start/End: Original strand, 32737828 - 32737873
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgt |
195 |
Q |
|
|
|||| |||| |||||||||||||||||| |||||||||| |||||| |
|
|
T |
32737828 |
ggtggccggagttcgaaccccagactttgcatatattatacattgt |
32737873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 156 - 225
Target Start/End: Complemental strand, 34436914 - 34436845
Alignment:
Q |
156 |
cggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
||||||| ||||||| | | || ||||||||||||||||| ||||||||||| ||||||| | |||||| |
|
|
T |
34436914 |
cggggtttgaaccccggcccttgcatatattatgcattgtccctaccaactgagctaagctcacgaggac |
34436845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 156 - 195
Target Start/End: Original strand, 5150080 - 5150120
Alignment:
Q |
156 |
cggggttcgaaccccagactttacata-tattatgcattgt |
195 |
Q |
|
|
||||||||||||||||||| ||||||| ||||||||||||| |
|
|
T |
5150080 |
cggggttcgaaccccagaccttacatattattatgcattgt |
5150120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 161 - 193
Target Start/End: Complemental strand, 7215808 - 7215776
Alignment:
Q |
161 |
ttcgaaccccagactttacatatattatgcatt |
193 |
Q |
|
|
|||||||||||||| |||||||||||||||||| |
|
|
T |
7215808 |
ttcgaaccccagaccttacatatattatgcatt |
7215776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 172 - 204
Target Start/End: Complemental strand, 10917377 - 10917345
Alignment:
Q |
172 |
gactttacatatattatgcattgtttctaccaa |
204 |
Q |
|
|
|||||| |||||||||||||||||||||||||| |
|
|
T |
10917377 |
gactttgcatatattatgcattgtttctaccaa |
10917345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 160 - 196
Target Start/End: Complemental strand, 14862118 - 14862082
Alignment:
Q |
160 |
gttcgaaccccagactttacatatattatgcattgtt |
196 |
Q |
|
|
|||||||||||| ||||| |||||||||||||||||| |
|
|
T |
14862118 |
gttcgaaccccaaactttgcatatattatgcattgtt |
14862082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 156 - 216
Target Start/End: Original strand, 17151840 - 17151900
Alignment:
Q |
156 |
cggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagct |
216 |
Q |
|
|
||||||| ||| || |||| || |||||||||| |||||| |||| ||||||||||||||| |
|
|
T |
17151840 |
cggggtttgaatccaagaccttgcatatattatacattgtctctagcaactgaactaagct |
17151900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 150 - 214
Target Start/End: Original strand, 21657390 - 21657454
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaag |
214 |
Q |
|
|
|||||| | |||| ||||| || || |||||||||||||||||||| |||| |||||||||||| |
|
|
T |
21657390 |
ggtgtctgaggtttgaacctcaaaccttacatatattatgcattgtccctacaaactgaactaag |
21657454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 150 - 214
Target Start/End: Complemental strand, 26377035 - 26376971
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaag |
214 |
Q |
|
|
||||||||| ||||||||||| ||| || |||||| |||||||||| |||||||||| ||||| |
|
|
T |
26377035 |
ggtgtccggagttcgaaccccggacgttgcatataatatgcattgtccttaccaactgagctaag |
26376971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 173 - 217
Target Start/End: Original strand, 26647961 - 26648005
Alignment:
Q |
173 |
actttacatatattatgcattgtttctaccaactgaactaagctt |
217 |
Q |
|
|
|||||||||||| ||||||||||| |||||||||| |||||||| |
|
|
T |
26647961 |
actttacatataatatgcattgttcataccaactgagctaagctt |
26648005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 173 - 217
Target Start/End: Original strand, 26919546 - 26919590
Alignment:
Q |
173 |
actttacatatattatgcattgtttctaccaactgaactaagctt |
217 |
Q |
|
|
|||||||||||| ||||||||||| |||||||||| |||||||| |
|
|
T |
26919546 |
actttacatataatatgcattgttcataccaactgagctaagctt |
26919590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 160 - 208
Target Start/End: Complemental strand, 30329161 - 30329113
Alignment:
Q |
160 |
gttcgaaccccagactttacatatattatgcattgtttctaccaactga |
208 |
Q |
|
|
||||||||||| ||| || | ||||||||||||||| |||||||||||| |
|
|
T |
30329161 |
gttcgaaccccggaccttgcgtatattatgcattgtctctaccaactga |
30329113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 150 - 225
Target Start/End: Complemental strand, 37461867 - 37461791
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatatt-atgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
|||||| ||||||||||| || ||||| |||| |||| |||||||||| ||| ||||||| |||| || |||||||| |
|
|
T |
37461867 |
ggtgtctggggttcgaactccggacttgacatgtatttatgcattgttcctatcaactgagctaaactcatgaggac |
37461791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 71)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 156 - 226
Target Start/End: Complemental strand, 32180893 - 32180823
Alignment:
Q |
156 |
cggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgaggacg |
226 |
Q |
|
|
|||||||||||||||||||||| ||||| ||||||||||| | |||||||||| ||||||| | ||||||| |
|
|
T |
32180893 |
cggggttcgaaccccagactttgcatattttatgcattgtctataccaactgagctaagctcacgaggacg |
32180823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 150 - 214
Target Start/End: Complemental strand, 27655799 - 27655736
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaag |
214 |
Q |
|
|
|||| ||||||||||||||| |||| || |||||||||||||||||||||| ||||||||||||| |
|
|
T |
27655799 |
ggtggccggggttcgaaccc-agaccttgcatatattatgcattgtttctatcaactgaactaag |
27655736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 150 - 216
Target Start/End: Complemental strand, 3936696 - 3936630
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagct |
216 |
Q |
|
|
|||| |||||||||||||||| ||| || |||||||||||||||||| |||||||||| ||||||| |
|
|
T |
3936696 |
ggtggccggggttcgaaccccggaccttgcatatattatgcattgttcataccaactgagctaagct |
3936630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 156 - 206
Target Start/End: Original strand, 22164267 - 22164317
Alignment:
Q |
156 |
cggggttcgaaccccagactttacatatattatgcattgtttctaccaact |
206 |
Q |
|
|
||||||| ||||||||||| ||||||||||||||||||||| ||||||||| |
|
|
T |
22164267 |
cggggtttgaaccccagaccttacatatattatgcattgttcctaccaact |
22164317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 164 - 225
Target Start/End: Complemental strand, 160764 - 160703
Alignment:
Q |
164 |
gaaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
||||||||||| ||||||||||||||||||||| |||| ||||||||||||| | |||||| |
|
|
T |
160764 |
gaaccccagaccttacatatattatgcattgttaatacctactgaactaagctcacgaggac |
160703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 150 - 227
Target Start/End: Original strand, 11144657 - 11144734
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgaggacga |
227 |
Q |
|
|
|||||||||||||| |||||||||| || ||||||||||||||||| | || ||||||| |||| | |||||||||| |
|
|
T |
11144657 |
ggtgtccggggttcaaaccccagaccttgcatatattatgcattgtctttatcaactgaggtaagttcatgaggacga |
11144734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 157 - 214
Target Start/End: Original strand, 37970173 - 37970230
Alignment:
Q |
157 |
ggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaag |
214 |
Q |
|
|
|||||||||||||| ||||||||||||||||| |||| ||| ||||||||||| |||| |
|
|
T |
37970173 |
ggggttcgaacccccgactttacatatattatacattttttataccaactgaattaag |
37970230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 150 - 225
Target Start/End: Complemental strand, 19587909 - 19587833
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatata-ttatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
||||||||||||| ||||||| ||||| ||||||| |||||||||||| ||| ||||||| |||| || |||||||| |
|
|
T |
19587909 |
ggtgtccggggtttgaaccccggacttgacatatatttatgcattgttcctatcaactgagctaaactcatgaggac |
19587833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 156 - 208
Target Start/End: Complemental strand, 34968405 - 34968353
Alignment:
Q |
156 |
cggggttcgaaccccagactttacatatattatgcattgtttctaccaactga |
208 |
Q |
|
|
|||||||||||| | ||||||||||||||||||||||| ||| |||||||||| |
|
|
T |
34968405 |
cggggttcgaactctagactttacatatattatgcattatttttaccaactga |
34968353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 164 - 216
Target Start/End: Complemental strand, 54500624 - 54500572
Alignment:
Q |
164 |
gaaccccagactttacatatattatgcattgtttctaccaactgaactaagct |
216 |
Q |
|
|
||||||| ||| |||||||||||||||||||| |||||||||||| ||||||| |
|
|
T |
54500624 |
gaaccccggaccttacatatattatgcattgtctctaccaactgagctaagct |
54500572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 170 - 225
Target Start/End: Original strand, 11286793 - 11286848
Alignment:
Q |
170 |
cagactttacatatattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
||||| || ||||||||||||||||| |||||||||||||||||||| | |||||| |
|
|
T |
11286793 |
cagaccttgcatatattatgcattgtctctaccaactgaactaagctcaggaggac |
11286848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 179 - 226
Target Start/End: Complemental strand, 41520994 - 41520947
Alignment:
Q |
179 |
catatattatgcattgtttctaccaactgaactaagcttatgaggacg |
226 |
Q |
|
|
||||||||||||||||| |||||||||||| |||||||||||||||| |
|
|
T |
41520994 |
catatattatgcattgtctctaccaactgagttaagcttatgaggacg |
41520947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 156 - 225
Target Start/End: Original strand, 11949761 - 11949830
Alignment:
Q |
156 |
cggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
||||||| ||||||| ||| || ||||||||||||||||| |||||||||| ||||||| |||||||| |
|
|
T |
11949761 |
cggggtttgaaccccggaccttgcatatattatgcattgtccataccaactgagctaagctcatgaggac |
11949830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 159 - 216
Target Start/End: Original strand, 21317339 - 21317396
Alignment:
Q |
159 |
ggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagct |
216 |
Q |
|
|
|||| ||||||| ||| || ||||||||||||||||| |||||||||||| ||||||| |
|
|
T |
21317339 |
ggtttgaacccctgaccttgcatatattatgcattgtctctaccaactgagctaagct |
21317396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 176 - 225
Target Start/End: Original strand, 34942429 - 34942478
Alignment:
Q |
176 |
ttacatatattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
||||||||||||| |||||| |||||||||||||||||||| ||| |||| |
|
|
T |
34942429 |
ttacatatattatacattgtctctaccaactgaactaagctcatggggac |
34942478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 150 - 195
Target Start/End: Original strand, 47806248 - 47806293
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgt |
195 |
Q |
|
|
||||| ||||||||||||||||||| || ||||||||||||||||| |
|
|
T |
47806248 |
ggtgttcggggttcgaaccccagaccttgcatatattatgcattgt |
47806293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 159 - 215
Target Start/End: Original strand, 7190449 - 7190505
Alignment:
Q |
159 |
ggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagc |
215 |
Q |
|
|
||||||||| || ||| ||||||||||||||||||||| |||||||||| |||||| |
|
|
T |
7190449 |
ggttcgaactccggacgttacatatattatgcattgttcttaccaactgagctaagc |
7190505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 152 - 208
Target Start/End: Original strand, 24785456 - 24785512
Alignment:
Q |
152 |
tgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactga |
208 |
Q |
|
|
||||||||||||||||||||||| || |||||||||||||||| |||||||||| |
|
|
T |
24785456 |
tgtccggggttcgaaccccagaccttgtatatattatgcattgtccttaccaactga |
24785512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 152 - 208
Target Start/End: Complemental strand, 24822810 - 24822754
Alignment:
Q |
152 |
tgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactga |
208 |
Q |
|
|
||||||||||||||||||||||| || |||||||||||||||| |||||||||| |
|
|
T |
24822810 |
tgtccggggttcgaaccccagaccttgtatatattatgcattgtccttaccaactga |
24822754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 150 - 226
Target Start/End: Original strand, 35287499 - 35287575
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgaggacg |
226 |
Q |
|
|
|||| |||||||| ||||||| ||| || ||||| |||||||||||| |||||||||| ||||||| | ||||||| |
|
|
T |
35287499 |
ggtggccggggttggaaccccggaccttgcatattttatgcattgttcataccaactgagctaagctcacgaggacg |
35287575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 49488546 - 49488598
Alignment:
Q |
161 |
ttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaa |
213 |
Q |
|
|
||||||||| | |||||||||||| ||| |||| ||||||||||||||||||| |
|
|
T |
49488546 |
ttcgaaccctaaactttacatataatatacattatttctaccaactgaactaa |
49488598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 161 - 216
Target Start/End: Original strand, 921488 - 921543
Alignment:
Q |
161 |
ttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagct |
216 |
Q |
|
|
||||||||||| |||||||||||| |||||||| | |||| ||||||| ||||||| |
|
|
T |
921488 |
ttcgaaccccaaactttacatataatatgcattatctctatcaactgagctaagct |
921543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 150 - 193
Target Start/End: Complemental strand, 3580783 - 3580740
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcatt |
193 |
Q |
|
|
||||||||||||||||| ||||||| || ||||||||||||||| |
|
|
T |
3580783 |
ggtgtccggggttcgaatcccagaccttgcatatattatgcatt |
3580740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 157 - 216
Target Start/End: Complemental strand, 6087809 - 6087750
Alignment:
Q |
157 |
ggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagct |
216 |
Q |
|
|
|||||| ||||||||||| || ||||||||||||||| | | |||||||||| ||||||| |
|
|
T |
6087809 |
ggggtttgaaccccagaccttgcatatattatgcattatctataccaactgagctaagct |
6087750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 161 - 216
Target Start/End: Complemental strand, 10006398 - 10006343
Alignment:
Q |
161 |
ttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagct |
216 |
Q |
|
|
|||||||||||||| || ||||||||||||||||| | |||||| ||| ||||||| |
|
|
T |
10006398 |
ttcgaaccccagaccttgcatatattatgcattgtctttaccaaatgacctaagct |
10006343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 158 - 213
Target Start/End: Original strand, 18903758 - 18903813
Alignment:
Q |
158 |
gggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaa |
213 |
Q |
|
|
||||| ||||||||||| |||||||||||||||||| ||| || ||||||| |||| |
|
|
T |
18903758 |
gggtttgaaccccagaccttacatatattatgcattatttttatcaactgagctaa |
18903813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 158 - 225
Target Start/End: Original strand, 20799394 - 20799461
Alignment:
Q |
158 |
gggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
||||| ||||||| ||| || ||||||||||||||||| ||||||||||| ||||||| | |||||| |
|
|
T |
20799394 |
gggtttgaaccccggaccttgcatatattatgcattgtccctaccaactgagctaagctcacgaggac |
20799461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 150 - 225
Target Start/End: Original strand, 23304008 - 23304083
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
|||| |||||||||| ||||| ||| || |||||||||||| |||| ||||||||||| ||||||| | |||||| |
|
|
T |
23304008 |
ggtggccggggttcgcaccccggaccttgcatatattatgccttgtccctaccaactgagctaagctcacgaggac |
23304083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 157 - 224
Target Start/End: Complemental strand, 23775580 - 23775513
Alignment:
Q |
157 |
ggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgagga |
224 |
Q |
|
|
||||||||||||| ||| || ||||||||||||||||| |||||||||| ||||||| ||||||| |
|
|
T |
23775580 |
ggggttcgaaccctggaccttgcatatattatgcattgtccctaccaactgtgctaagctcatgagga |
23775513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 150 - 224
Target Start/End: Original strand, 29346299 - 29346374
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatatt-atgcattgtttctaccaactgaactaagcttatgagga |
224 |
Q |
|
|
||||||||||||||||||| | || || |||||||| ||||||||| |||| ||||||| ||||||| ||||||| |
|
|
T |
29346299 |
ggtgtccggggttcgaacctcggatgttgcatatatttatgcattgtctctatcaactgagctaagctcatgagga |
29346374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 150 - 225
Target Start/End: Original strand, 46676490 - 46676565
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
|||||| |||| ||||||||| ||| || ||||||||||||||||| |||||||||| ||||||| ||| |||| |
|
|
T |
46676490 |
ggtgtctgggggtcgaaccccggaccttgcatatattatgcattgtccttaccaactgagctaagctcatggggac |
46676565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 150 - 225
Target Start/End: Original strand, 54857607 - 54857682
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
|||| |||||||| ||||||| ||| || ||||| ||||||||||||| ||||||| || ||||||| | |||||| |
|
|
T |
54857607 |
ggtggccggggtttgaaccccggaccttgcatattttatgcattgtttataccaaccgagctaagctcacgaggac |
54857682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 150 - 216
Target Start/End: Original strand, 9114954 - 9115020
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagct |
216 |
Q |
|
|
||||||||| |||||||| || |||||||||||||||| |||||| | || ||||||| ||||||| |
|
|
T |
9114954 |
ggtgtccggagttcgaactacaaactttacatatattattcattgtctttaacaactgagctaagct |
9115020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 179 - 225
Target Start/End: Original strand, 12192512 - 12192558
Alignment:
Q |
179 |
catatattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
|||||||||||||||||| |||||| ||||||||| |||||||||| |
|
|
T |
12192512 |
catatattatgcattgttcataccaattgaactaagtttatgaggac |
12192558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 150 - 216
Target Start/End: Complemental strand, 19854634 - 19854568
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagct |
216 |
Q |
|
|
|||||||| |||||||||||| || || ||||||||||||||||| |||||||||| ||||||| |
|
|
T |
19854634 |
ggtgtccgaggttcgaaccccggatcttgcatatattatgcattgtccataccaactgagctaagct |
19854568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 176 - 214
Target Start/End: Original strand, 21442859 - 21442897
Alignment:
Q |
176 |
ttacatatattatgcattgtttctaccaactgaactaag |
214 |
Q |
|
|
|||||||||||||||| |||||||||||||| ||||||| |
|
|
T |
21442859 |
ttacatatattatgcaatgtttctaccaacttaactaag |
21442897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 150 - 208
Target Start/End: Original strand, 34595928 - 34595986
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactga |
208 |
Q |
|
|
|||||| ||||||| |||||| ||||||||||||||||||||||| |||||||||| |
|
|
T |
34595928 |
ggtgtctggggttcaaaccccgaactttacatatattatgcattgtccttaccaactga |
34595986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 158 - 216
Target Start/End: Complemental strand, 44221508 - 44221450
Alignment:
Q |
158 |
gggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagct |
216 |
Q |
|
|
||||||||||| ||||| || ||||||||||||||||| ||||||||||| |||||| |
|
|
T |
44221508 |
gggttcgaacctcagaccttgcatatattatgcattgtccataccaactgaattaagct |
44221450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 150 - 216
Target Start/End: Original strand, 56497600 - 56497666
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagct |
216 |
Q |
|
|
|||| ||||| |||||||||||||| || ||||||||||||||||| |||||| ||| ||||||| |
|
|
T |
56497600 |
ggtggccgggattcgaaccccagaccttgcatatattatgcattgtccttaccaattgagctaagct |
56497666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 158 - 195
Target Start/End: Original strand, 1657030 - 1657067
Alignment:
Q |
158 |
gggttcgaaccccagactttacatatattatgcattgt |
195 |
Q |
|
|
|||||||||||||| || |||||||||||||||||||| |
|
|
T |
1657030 |
gggttcgaaccccaaaccttacatatattatgcattgt |
1657067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 150 - 195
Target Start/End: Original strand, 7371540 - 7371585
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgt |
195 |
Q |
|
|
||||||||||||||||||||| ||| || ||||||||||| ||||| |
|
|
T |
7371540 |
ggtgtccggggttcgaaccccggaccttgcatatattatgtattgt |
7371585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 176 - 225
Target Start/End: Original strand, 8415513 - 8415562
Alignment:
Q |
176 |
ttacatatattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
|||||||||||||||||||| ||||||||||| |||||| |||||||| |
|
|
T |
8415513 |
ttacatatattatgcattgtccataccaactgaattaagctcatgaggac |
8415562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 160 - 225
Target Start/End: Complemental strand, 11198823 - 11198758
Alignment:
Q |
160 |
gttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
||||||||||||||| |||||||| ||||||||| | |||||||||| ||||||| | |||||| |
|
|
T |
11198823 |
gttcgaaccccagaccttacatattttatgcattctccataccaactgagctaagctcacgaggac |
11198758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 158 - 195
Target Start/End: Original strand, 14542760 - 14542797
Alignment:
Q |
158 |
gggttcgaaccccagactttacatatattatgcattgt |
195 |
Q |
|
|
||||||||||||||||| || ||||||||||||||||| |
|
|
T |
14542760 |
gggttcgaaccccagaccttgcatatattatgcattgt |
14542797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 159 - 216
Target Start/End: Original strand, 20403169 - 20403226
Alignment:
Q |
159 |
ggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagct |
216 |
Q |
|
|
||||||||| ||||| || |||||||||||||||||| ||| ||||||| ||||||| |
|
|
T |
20403169 |
ggttcgaacttcagaccttgcatatattatgcattgttcctatcaactgagctaagct |
20403226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 165 - 214
Target Start/End: Original strand, 21623426 - 21623475
Alignment:
Q |
165 |
aaccccagactttacatatattatgcattgtttctaccaactgaactaag |
214 |
Q |
|
|
|||| ||||| || ||||||||||||||||| ||||||||||||||||| |
|
|
T |
21623426 |
aacctcagaccttgcatatattatgcattgtccctaccaactgaactaag |
21623475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 156 - 225
Target Start/End: Original strand, 24664989 - 24665058
Alignment:
Q |
156 |
cggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
||||||||||||||| ||| || ||||||||||||||| | |||||||||| ||||||| | |||||| |
|
|
T |
24664989 |
cggggttcgaaccccggaccttgcatatattatgcattctccataccaactgagctaagctcacgaggac |
24665058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 150 - 195
Target Start/End: Complemental strand, 29568655 - 29568610
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgt |
195 |
Q |
|
|
|||||| |||||||||||| | ||| |||||||||||||||||||| |
|
|
T |
29568655 |
ggtgtctggggttcgaacctcggaccttacatatattatgcattgt |
29568610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 159 - 216
Target Start/End: Original strand, 29681458 - 29681515
Alignment:
Q |
159 |
ggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagct |
216 |
Q |
|
|
|||||||||| ||||| || ||||| ||||||||||| |||||||||||||||||| |
|
|
T |
29681458 |
ggttcgaacctcagacattgcatattttatgcattgtccataccaactgaactaagct |
29681515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 150 - 195
Target Start/End: Complemental strand, 30420911 - 30420866
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgt |
195 |
Q |
|
|
||||||| |||||||||||| |||| ||||||||||||| |||||| |
|
|
T |
30420911 |
ggtgtccagggttcgaaccctagaccttacatatattatacattgt |
30420866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 156 - 225
Target Start/End: Complemental strand, 36479054 - 36478985
Alignment:
Q |
156 |
cggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
||||||||||||| | || |||||||||||||||||||| ||||||| || ||||||| |||||||| |
|
|
T |
36479054 |
cggggttcgaacctcgaaccttacatatattatgcattgtccataccaacagagctaagctcatgaggac |
36478985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 158 - 195
Target Start/End: Complemental strand, 37255009 - 37254972
Alignment:
Q |
158 |
gggttcgaaccccagactttacatatattatgcattgt |
195 |
Q |
|
|
||||||||||||| ||| |||||||||||||||||||| |
|
|
T |
37255009 |
gggttcgaaccccggaccttacatatattatgcattgt |
37254972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 150 - 195
Target Start/End: Complemental strand, 39974571 - 39974526
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgt |
195 |
Q |
|
|
|||||||| |||| ||||||||||| || ||||||||||||||||| |
|
|
T |
39974571 |
ggtgtccgaggtttgaaccccagaccttccatatattatgcattgt |
39974526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 179 - 208
Target Start/End: Original strand, 45970728 - 45970757
Alignment:
Q |
179 |
catatattatgcattgtttctaccaactga |
208 |
Q |
|
|
|||||||||||||||||||||||||||||| |
|
|
T |
45970728 |
catatattatgcattgtttctaccaactga |
45970757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 150 - 227
Target Start/End: Complemental strand, 48955361 - 48955284
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgaggacga |
227 |
Q |
|
|
||||| || |||||||||||| |||||| ||||||||| ||||||| |||||||||| |||||| | |||||||| |
|
|
T |
48955361 |
ggtgttcgaggttcgaaccccggactttgcatatattacgcattgtccttaccaactgagataagctcacgaggacga |
48955284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 158 - 195
Target Start/End: Complemental strand, 49308881 - 49308844
Alignment:
Q |
158 |
gggttcgaaccccagactttacatatattatgcattgt |
195 |
Q |
|
|
||||||||||||||||| || ||||||||||||||||| |
|
|
T |
49308881 |
gggttcgaaccccagaccttgcatatattatgcattgt |
49308844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 158 - 218
Target Start/End: Original strand, 2649733 - 2649793
Alignment:
Q |
158 |
gggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagctta |
218 |
Q |
|
|
|||||||||| || ||| || ||||||||||||||||| ||||||||||| |||| |||| |
|
|
T |
2649733 |
gggttcgaactccggaccttgcatatattatgcattgtccctaccaactgagctaaactta |
2649793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 151 - 195
Target Start/End: Complemental strand, 6474507 - 6474463
Alignment:
Q |
151 |
gtgtccggggttcgaaccccagactttacatatattatgcattgt |
195 |
Q |
|
|
|||||||||||||||||||||||| || | ||||| ||||||||| |
|
|
T |
6474507 |
gtgtccggggttcgaaccccagaccttgcttatatgatgcattgt |
6474463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 161 - 225
Target Start/End: Original strand, 9028075 - 9028139
Alignment:
Q |
161 |
ttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
|||||||||||||| |||||||| ||||||||||| ||||||| | | ||||||| | |||||| |
|
|
T |
9028075 |
ttcgaaccccagaccttacatattttatgcattgtccctaccaattaagctaagctcaggaggac |
9028139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 164 - 208
Target Start/End: Original strand, 17423183 - 17423227
Alignment:
Q |
164 |
gaaccccagactttacatatattatgcattgtttctaccaactga |
208 |
Q |
|
|
||||||| ||| || ||||||||||||||||| |||||||||||| |
|
|
T |
17423183 |
gaaccccggaccttgcatatattatgcattgtctctaccaactga |
17423227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 152 - 188
Target Start/End: Original strand, 19486703 - 19486739
Alignment:
Q |
152 |
tgtccggggttcgaaccccagactttacatatattat |
188 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||| |
|
|
T |
19486703 |
tgtccggggttcgaaccccagatcttacatatattat |
19486739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 164 - 208
Target Start/End: Original strand, 19997370 - 19997414
Alignment:
Q |
164 |
gaaccccagactttacatatattatgcattgtttctaccaactga |
208 |
Q |
|
|
||||||| ||||| ||||||||||||||||| |||||||||||| |
|
|
T |
19997370 |
gaaccccgaactttgcatatattatgcattgtctctaccaactga |
19997414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 156 - 208
Target Start/End: Original strand, 21318251 - 21318303
Alignment:
Q |
156 |
cggggttcgaaccccagactttacatatattatgcattgtttctaccaactga |
208 |
Q |
|
|
||||||| |||||| |||| || ||||||||||||||||| ||||||||||| |
|
|
T |
21318251 |
cggggtttgaaccctagaccttgcatatattatgcattgtccctaccaactga |
21318303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 156 - 208
Target Start/End: Original strand, 22630358 - 22630410
Alignment:
Q |
156 |
cggggttcgaaccccagactttacatatattatgcattgtttctaccaactga |
208 |
Q |
|
|
||||||| ||||| ||||| || ||||||||||||||||| ||||||||||| |
|
|
T |
22630358 |
cggggtttgaacctcagaccttgcatatattatgcattgtcactaccaactga |
22630410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 165 - 225
Target Start/End: Original strand, 31041372 - 31041432
Alignment:
Q |
165 |
aaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
|||||||||| || |||||||||| ||||||||||||||| ||| |||||| | |||||| |
|
|
T |
31041372 |
aaccccagaccttgcatatattatacattgtttctaccaaatgagttaagctcacgaggac |
31041432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 176 - 216
Target Start/End: Original strand, 36199318 - 36199358
Alignment:
Q |
176 |
ttacatatattatgcattgtttctaccaactgaactaagct |
216 |
Q |
|
|
|||||||||||||||||||||| |||| || |||||||||| |
|
|
T |
36199318 |
ttacatatattatgcattgtttttacccaccgaactaagct |
36199358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 150 - 206
Target Start/End: Complemental strand, 38375026 - 38374970
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaact |
206 |
Q |
|
|
|||| |||||||| |||| |||||| || ||||||||||||||||| ||||||||| |
|
|
T |
38375026 |
ggtggccggggtttgaactccagaccttgcatatattatgcattgtccctaccaact |
38374970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 157 - 225
Target Start/End: Complemental strand, 49473707 - 49473639
Alignment:
Q |
157 |
ggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
|||||||||||||| ||| || ||||||||||||||||| ||||||||| ||||||| | |||||| |
|
|
T |
49473707 |
ggggttcgaaccccggaccttgcatatattatgcattgtccttaccaactgggctaagctcacgaggac |
49473639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 176 - 216
Target Start/End: Original strand, 50380854 - 50380894
Alignment:
Q |
176 |
ttacatatattatgcattgtttctaccaactgaactaagct |
216 |
Q |
|
|
||||||||||||||||||||| ||||||||||| |||||| |
|
|
T |
50380854 |
ttacatatattatgcattgttcataccaactgaattaagct |
50380894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 176 - 216
Target Start/End: Original strand, 50937566 - 50937606
Alignment:
Q |
176 |
ttacatatattatgcattgtttctaccaactgaactaagct |
216 |
Q |
|
|
||||||||||||||| ||||| |||||||||||||||||| |
|
|
T |
50937566 |
ttacatatattatgctttgttcttaccaactgaactaagct |
50937606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 155 - 195
Target Start/End: Original strand, 52132299 - 52132339
Alignment:
Q |
155 |
ccggggttcgaaccccagactttacatatattatgcattgt |
195 |
Q |
|
|
|||||||||||||| ||||| || ||||||||||||||||| |
|
|
T |
52132299 |
ccggggttcgaaccacagaccttgcatatattatgcattgt |
52132339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 43)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 150 - 207
Target Start/End: Original strand, 9192219 - 9192276
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactg |
207 |
Q |
|
|
|||| |||||||| ||||||||||||||||||||||||||||||||| ||||||||| |
|
|
T |
9192219 |
ggtggccggggtttgaaccccagactttacatatattatgcattgttcataccaactg |
9192276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 159 - 226
Target Start/End: Original strand, 32223880 - 32223947
Alignment:
Q |
159 |
ggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgaggacg |
226 |
Q |
|
|
|||| |||| ||||||||| ||||||||||||||||| |||| ||||||||||||||| | ||||||| |
|
|
T |
32223880 |
ggtttgaactccagactttgcatatattatgcattgtctctatcaactgaactaagctcacgaggacg |
32223947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 158 - 225
Target Start/End: Complemental strand, 44293636 - 44293569
Alignment:
Q |
158 |
gggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
|||||||||||||||| |||||||||||||||||||| | |||||||||| ||||||| | |||||| |
|
|
T |
44293636 |
gggttcgaaccccagatcttacatatattatgcattgtctataccaactgagctaagctcacgaggac |
44293569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 151 - 216
Target Start/End: Complemental strand, 30623361 - 30623296
Alignment:
Q |
151 |
gtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagct |
216 |
Q |
|
|
|||| ||||||||||||||||||| || ||||||||||||||||| |||||||||| ||||||| |
|
|
T |
30623361 |
gtgttcggggttcgaaccccagaccttgcatatattatgcattgtccttaccaactgagctaagct |
30623296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 150 - 214
Target Start/End: Original strand, 1244697 - 1244761
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaag |
214 |
Q |
|
|
||||||||||||||||||||||||| || |||||||||||||||| |||||||||| ||||| |
|
|
T |
1244697 |
ggtgtccggggttcgaaccccagaccttgtatatattatgcattgtccttaccaactgagctaag |
1244761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 158 - 225
Target Start/End: Complemental strand, 39821945 - 39821878
Alignment:
Q |
158 |
gggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
||||| ||||||||||| || ||||||||||||||||| ||||||||||| ||||||| | |||||| |
|
|
T |
39821945 |
gggtttgaaccccagaccttgcatatattatgcattgtccctaccaactgagctaagctcacgaggac |
39821878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 157 - 216
Target Start/End: Complemental strand, 41625256 - 41625197
Alignment:
Q |
157 |
ggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagct |
216 |
Q |
|
|
||||||||||||| |||| |||||||||||||||||| || |||||||||| ||||||| |
|
|
T |
41625256 |
ggggttcgaaccctagaccttacatatattatgcattattcataccaactgagctaagct |
41625197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 150 - 208
Target Start/End: Complemental strand, 3650589 - 3650531
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactga |
208 |
Q |
|
|
|||| |||||||| ||||||| || |||||||||||||||||| |||||||||||||| |
|
|
T |
3650589 |
ggtggccggggtttgaaccccgaaccttacatatattatgcattttttctaccaactga |
3650531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 156 - 226
Target Start/End: Complemental strand, 8137998 - 8137928
Alignment:
Q |
156 |
cggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgaggacg |
226 |
Q |
|
|
||||||| |||||||| ||||| ||||| ||||||||||| |||||||||| ||||||||| ||||||| |
|
|
T |
8137998 |
cggggtttgaaccccaaactttgcatattttatgcattgtccataccaactgagctaagcttacgaggacg |
8137928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 150 - 216
Target Start/End: Original strand, 12700989 - 12701055
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagct |
216 |
Q |
|
|
||||||||| ||||||||| | |||||| |||||||||||||||||| |||||| ||| ||||||| |
|
|
T |
12700989 |
ggtgtccggagttcgaacctcggactttgcatatattatgcattgttattaccaattgagctaagct |
12701055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 176 - 218
Target Start/End: Original strand, 18422471 - 18422513
Alignment:
Q |
176 |
ttacatatattatgcattgtttctaccaactgaactaagctta |
218 |
Q |
|
|
||||||||||||||||||||||||| |||||||| |||||||| |
|
|
T |
18422471 |
ttacatatattatgcattgtttctatcaactgaattaagctta |
18422513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 156 - 218
Target Start/End: Original strand, 31336805 - 31336867
Alignment:
Q |
156 |
cggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagctta |
218 |
Q |
|
|
||||||| |||||| |||| || |||||||||||||||||| ||||||||||| |||||||| |
|
|
T |
31336805 |
cggggtttgaaccctagaccttgcatatattatgcattgttcctaccaactgacttaagctta |
31336867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 150 - 216
Target Start/End: Complemental strand, 42367798 - 42367732
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagct |
216 |
Q |
|
|
||||||| |||||||||| || |||||| |||||||||||||||||| || ||||||| ||||||| |
|
|
T |
42367798 |
ggtgtccagggttcgaactccggacttttcatatattatgcattgttcttatcaactgagctaagct |
42367732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 176 - 225
Target Start/End: Complemental strand, 8020353 - 8020304
Alignment:
Q |
176 |
ttacatatattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
||||||||||||||| ||||| ||||||||||| ||||||||| |||||| |
|
|
T |
8020353 |
ttacatatattatgcgttgttcctaccaactgagctaagcttacgaggac |
8020304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 155 - 216
Target Start/End: Original strand, 31466242 - 31466303
Alignment:
Q |
155 |
ccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagct |
216 |
Q |
|
|
||||||||||||||| |||| |||||| ||||||||||||| |||||||||| ||||||| |
|
|
T |
31466242 |
ccggggttcgaacccgagaccttacatctattatgcattgtacttaccaactgagctaagct |
31466303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 150 - 214
Target Start/End: Complemental strand, 39201518 - 39201453
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatatt-atgcattgtttctaccaactgaactaag |
214 |
Q |
|
|
||||||| |||||||||| || ||||| ||||||||| |||||||||||||| ||||||| ||||| |
|
|
T |
39201518 |
ggtgtccagggttcgaactccggacttgacatatatttatgcattgtttctatcaactgagctaag |
39201453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 165 - 204
Target Start/End: Complemental strand, 2181182 - 2181143
Alignment:
Q |
165 |
aaccccagactttacatatattatgcattgtttctaccaa |
204 |
Q |
|
|
|||||||||| ||||||||||||||||||||| ||||||| |
|
|
T |
2181182 |
aaccccagaccttacatatattatgcattgttcctaccaa |
2181143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 159 - 214
Target Start/End: Complemental strand, 11754313 - 11754258
Alignment:
Q |
159 |
ggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaag |
214 |
Q |
|
|
|||| |||||| | |||||||||||||||| |||||||||||| |||||| ||||| |
|
|
T |
11754313 |
ggtttgaacccgaaactttacatatattatacattgtttctactaactgagctaag |
11754258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 150 - 213
Target Start/End: Complemental strand, 13958880 - 13958817
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaa |
213 |
Q |
|
|
||||| |||| ||||||||||| || |||||||||||||||||| | ||| |||||||| |||| |
|
|
T |
13958880 |
ggtgttcgggattcgaaccccaaaccttacatatattatgcattatatctgccaactgagctaa |
13958817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 157 - 216
Target Start/End: Original strand, 20469310 - 20469369
Alignment:
Q |
157 |
ggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagct |
216 |
Q |
|
|
||||||||||| || || || ||||||||||||||||||| |||||||||| ||||||| |
|
|
T |
20469310 |
ggggttcgaactccgaaccttgcatatattatgcattgtttataccaactgatctaagct |
20469369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 150 - 213
Target Start/End: Original strand, 37749991 - 37750054
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaa |
213 |
Q |
|
|
|||| ||||||||| |||||| |||||| |||||||||||||||||| || ||||||| |||| |
|
|
T |
37749991 |
ggtggccggggttcaaaccccggactttgcatatattatgcattgttcatatcaactgagctaa |
37750054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 157 - 195
Target Start/End: Complemental strand, 7433202 - 7433164
Alignment:
Q |
157 |
ggggttcgaaccccagactttacatatattatgcattgt |
195 |
Q |
|
|
|||||||||| ||||||| |||||||||||||||||||| |
|
|
T |
7433202 |
ggggttcgaatcccagaccttacatatattatgcattgt |
7433164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 156 - 225
Target Start/End: Original strand, 8999889 - 8999959
Alignment:
Q |
156 |
cggggttcgaaccccagactttacatatattatgca-ttgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
||||||| |||||| |||||| ||||||||||||| |||| |||||||||||| ||||||| | |||||| |
|
|
T |
8999889 |
cggggtttgaaccctggactttgcatatattatgcatttgtctctaccaactgagctaagctcacgaggac |
8999959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 156 - 214
Target Start/End: Complemental strand, 18638163 - 18638105
Alignment:
Q |
156 |
cggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaag |
214 |
Q |
|
|
||||||| |||||||| ||||| ||||| |||||||||||| | ||||||||| ||||| |
|
|
T |
18638163 |
cggggtttgaaccccatactttgcatattttatgcattgttccaaccaactgagctaag |
18638105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 158 - 216
Target Start/End: Original strand, 26914071 - 26914129
Alignment:
Q |
158 |
gggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagct |
216 |
Q |
|
|
||||||||||||||||| |||||||| |||| |||| | | || ||||||||||||||| |
|
|
T |
26914071 |
gggttcgaaccccagaccttacatattttatacattatctatagcaactgaactaagct |
26914129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 179 - 225
Target Start/End: Original strand, 37015857 - 37015903
Alignment:
Q |
179 |
catatattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
||||||||||||||||| |||||||||||| ||||||| | |||||| |
|
|
T |
37015857 |
catatattatgcattgtctctaccaactgagctaagctcacgaggac |
37015903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 158 - 196
Target Start/End: Complemental strand, 41603122 - 41603084
Alignment:
Q |
158 |
gggttcgaaccccagactttacatatattatgcattgtt |
196 |
Q |
|
|
||||| ||||||||||| ||||||||||||||||||||| |
|
|
T |
41603122 |
gggtttgaaccccagaccttacatatattatgcattgtt |
41603084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 176 - 218
Target Start/End: Original strand, 43073454 - 43073496
Alignment:
Q |
176 |
ttacatatattatgcattgtttctaccaactgaactaagctta |
218 |
Q |
|
|
|||||||||||||||||||||| |||||||||| |||||||| |
|
|
T |
43073454 |
ttacatatattatgcattgtttttaccaactgagttaagctta |
43073496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 164 - 213
Target Start/End: Original strand, 3757963 - 3758012
Alignment:
Q |
164 |
gaaccccagactttacatatattatgcattgtttctaccaactgaactaa |
213 |
Q |
|
|
|||||||||| ||||||||||||||||||||| ||| ||||||| |||| |
|
|
T |
3757963 |
gaaccccagatcttacatatattatgcattgttcctatcaactgagctaa |
3758012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 150 - 195
Target Start/End: Original strand, 19260571 - 19260616
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgt |
195 |
Q |
|
|
|||| |||||||| ||||||| ||| |||||||||||||||||||| |
|
|
T |
19260571 |
ggtggccggggtttgaaccccggaccttacatatattatgcattgt |
19260616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 150 - 195
Target Start/End: Original strand, 27044882 - 27044927
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgt |
195 |
Q |
|
|
||||||||||||| ||||| ||||| |||||||||||||| ||||| |
|
|
T |
27044882 |
ggtgtccggggtttgaacctcagaccttacatatattatgaattgt |
27044927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 156 - 193
Target Start/End: Complemental strand, 28440022 - 28439985
Alignment:
Q |
156 |
cggggttcgaaccccagactttacatatattatgcatt |
193 |
Q |
|
|
||||||| ||||||||||| |||||||||||||||||| |
|
|
T |
28440022 |
cggggtttgaaccccagaccttacatatattatgcatt |
28439985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 150 - 195
Target Start/End: Original strand, 31832082 - 31832127
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgt |
195 |
Q |
|
|
||||||||||||||||| ||| ||| || ||||||||||||||||| |
|
|
T |
31832082 |
ggtgtccggggttcgaaacccggacattgcatatattatgcattgt |
31832127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 180 - 225
Target Start/End: Complemental strand, 33445609 - 33445564
Alignment:
Q |
180 |
atatattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
||||||||||||||||| ||||||||||| ||||||| | |||||| |
|
|
T |
33445609 |
atatattatgcattgttcctaccaactgagctaagctcacgaggac |
33445564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 158 - 195
Target Start/End: Original strand, 38763515 - 38763552
Alignment:
Q |
158 |
gggttcgaaccccagactttacatatattatgcattgt |
195 |
Q |
|
|
||||||||||||||||| || ||||||||||||||||| |
|
|
T |
38763515 |
gggttcgaaccccagaccttgcatatattatgcattgt |
38763552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 160 - 216
Target Start/End: Complemental strand, 574443 - 574387
Alignment:
Q |
160 |
gttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagct |
216 |
Q |
|
|
|||||||| || ||| |||||||||||||||||||| | || ||||||| ||||||| |
|
|
T |
574443 |
gttcgaactccggaccttacatatattatgcattgtctatatcaactgagctaagct |
574387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 176 - 208
Target Start/End: Original strand, 1230679 - 1230711
Alignment:
Q |
176 |
ttacatatattatgcattgtttctaccaactga |
208 |
Q |
|
|
||||||||||||||||||||| ||||||||||| |
|
|
T |
1230679 |
ttacatatattatgcattgttcctaccaactga |
1230711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 157 - 208
Target Start/End: Complemental strand, 7404840 - 7404788
Alignment:
Q |
157 |
ggggttcgaaccccagactttacatatattatgca-ttgtttctaccaactga |
208 |
Q |
|
|
|||||||||||| ||||| ||| |||||||||||| |||| |||||||||||| |
|
|
T |
7404840 |
ggggttcgaacctcagaccttatatatattatgcatttgtctctaccaactga |
7404788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 156 - 216
Target Start/End: Complemental strand, 7997003 - 7996943
Alignment:
Q |
156 |
cggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagct |
216 |
Q |
|
|
||||||| ||||||||||| || |||||||||||| |||| |||||||||| ||||||| |
|
|
T |
7997003 |
cggggtttgaaccccagaccttgcatatattatgcgttgtccataccaactgagctaagct |
7996943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 176 - 204
Target Start/End: Complemental strand, 12959332 - 12959304
Alignment:
Q |
176 |
ttacatatattatgcattgtttctaccaa |
204 |
Q |
|
|
||||||||||||||||||||||||||||| |
|
|
T |
12959332 |
ttacatatattatgcattgtttctaccaa |
12959304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 159 - 195
Target Start/End: Complemental strand, 15188959 - 15188923
Alignment:
Q |
159 |
ggttcgaaccccagactttacatatattatgcattgt |
195 |
Q |
|
|
||||||||||||||| |||||||||||||||||||| |
|
|
T |
15188959 |
ggttcgaaccccagatcttacatatattatgcattgt |
15188923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 164 - 208
Target Start/End: Complemental strand, 33996124 - 33996080
Alignment:
Q |
164 |
gaaccccagactttacatatattatgcattgtttctaccaactga |
208 |
Q |
|
|
||||||| ||||| ||||||||||||||||| |||||||||||| |
|
|
T |
33996124 |
gaaccccgaactttgcatatattatgcattgtctctaccaactga |
33996080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 150 - 225
Target Start/End: Complemental strand, 34997528 - 34997452
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatata-ttatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
|||||||||||||||||||| ||| || |||||| ||||||||||| | || ||||||| ||||||| | |||||| |
|
|
T |
34997528 |
ggtgtccggggttcgaacccatgaccttgcatatatttatgcattgtctatatcaactgagctaagctcacgaggac |
34997452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 59)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 158 - 207
Target Start/End: Complemental strand, 9139514 - 9139465
Alignment:
Q |
158 |
gggttcgaaccccagactttacatatattatgcattgtttctaccaactg |
207 |
Q |
|
|
|||||||||| |||||||||||||||||||||||||||||| |||||||| |
|
|
T |
9139514 |
gggttcgaactccagactttacatatattatgcattgtttccaccaactg |
9139465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 150 - 225
Target Start/End: Original strand, 40187628 - 40187703
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
||||| ||||||| ||||| ||||| |||||||||||||||||||| ||||||||||| |||||| |||||||| |
|
|
T |
40187628 |
ggtgttcggggtttgaaccgcagaccttacatatattatgcattgtccctaccaactgagttaagctcatgaggac |
40187703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 152 - 214
Target Start/End: Complemental strand, 38553885 - 38553823
Alignment:
Q |
152 |
tgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaag |
214 |
Q |
|
|
|||||| ||||||||||||| || ||||||||||||||||||||| |||||||||| ||||| |
|
|
T |
38553885 |
tgtccgaggttcgaaccccaaaccttacatatattatgcattgttcttaccaactgagctaag |
38553823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 150 - 216
Target Start/End: Complemental strand, 46987155 - 46987089
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagct |
216 |
Q |
|
|
||||||||||||||||||||| ||| || ||||||||||||||||| |||||||||| ||||||| |
|
|
T |
46987155 |
ggtgtccggggttcgaaccccggaccttgcatatattatgcattgtccttaccaactgagctaagct |
46987089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 180 - 225
Target Start/End: Original strand, 47667960 - 47668005
Alignment:
Q |
180 |
atatattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
|||||||||||||||||||||| |||||||||||||| |||||||| |
|
|
T |
47667960 |
atatattatgcattgtttctacaaactgaactaagctcatgaggac |
47668005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 150 - 225
Target Start/End: Original strand, 4491107 - 4491183
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatata-ttatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
||||||||||||||||||| ||||||| |||||| |||||||||||| ||| ||||||| ||||||| | |||||| |
|
|
T |
4491107 |
ggtgtccggggttcgaacctcagacttggcatatatttatgcattgttactatcaactgagctaagctcacgaggac |
4491183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 150 - 214
Target Start/End: Original strand, 7872740 - 7872804
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaag |
214 |
Q |
|
|
||||||| ||||||||||||||||| || ||||||||||||||||| |||||||||| ||||| |
|
|
T |
7872740 |
ggtgtcctgggttcgaaccccagaccttgcatatattatgcattgtccttaccaactgagctaag |
7872804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 150 - 214
Target Start/End: Complemental strand, 9522981 - 9522917
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaag |
214 |
Q |
|
|
|||| ||||||||||||||||| || || |||||||||||||||||| |||||||||| ||||| |
|
|
T |
9522981 |
ggtggccggggttcgaaccccaaaccttgcatatattatgcattgttcataccaactgagctaag |
9522917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 150 - 225
Target Start/End: Original strand, 22690028 - 22690103
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
|||||||||||||||||||||| || || ||||||||||||||| || || ||||||| ||||||| | |||||| |
|
|
T |
22690028 |
ggtgtccggggttcgaaccccaaaccttgcatatattatgcattattcttagcaactgagctaagctcacgaggac |
22690103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 150 - 216
Target Start/End: Original strand, 23069849 - 23069915
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagct |
216 |
Q |
|
|
|||||||||||||||||||||| || || ||||||||||| |||| | |||||||||| ||||||| |
|
|
T |
23069849 |
ggtgtccggggttcgaaccccataccttgcatatattatgtgttgtctttaccaactgagctaagct |
23069915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 150 - 208
Target Start/End: Complemental strand, 34809414 - 34809356
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactga |
208 |
Q |
|
|
|||||| ||||||||||| || |||||||||||||||||||||||| |||| |||||| |
|
|
T |
34809414 |
ggtgtctggggttcgaactcctgactttacatatattatgcattgtccctactaactga |
34809356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 158 - 216
Target Start/End: Original strand, 43539104 - 43539162
Alignment:
Q |
158 |
gggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagct |
216 |
Q |
|
|
||||| ||||||| ||| ||||||||||||||||||||| ||| ||||||| ||||||| |
|
|
T |
43539104 |
gggtttgaaccccggaccttacatatattatgcattgttcctatcaactgagctaagct |
43539162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 156 - 225
Target Start/End: Original strand, 27833399 - 27833468
Alignment:
Q |
156 |
cggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
||||||| ||||||| ||| |||||||||||||||||||| |||||||||| ||| ||||| |||||| |
|
|
T |
27833399 |
cggggtttgaaccccggaccttacatatattatgcattgtccttaccaactgagctaggcttacgaggac |
27833468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 158 - 216
Target Start/End: Original strand, 29166275 - 29166335
Alignment:
Q |
158 |
gggttcgaaccccagac--tttacatatattatgcattgtttctaccaactgaactaagct |
216 |
Q |
|
|
||||||||||||||||| ||| |||| ||||||||||||| |||||||||||||||||| |
|
|
T |
29166275 |
gggttcgaaccccagaccttttgtatattttatgcattgtttttaccaactgaactaagct |
29166335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 152 - 208
Target Start/End: Complemental strand, 2916169 - 2916113
Alignment:
Q |
152 |
tgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactga |
208 |
Q |
|
|
||||||||||||||| ||||||| || ||||||||||||||||| |||||||||| |
|
|
T |
2916169 |
tgtccggggttcgaatcccagaccttgcatatattatgcattgtccgtaccaactga |
2916113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 156 - 216
Target Start/End: Complemental strand, 5579756 - 5579696
Alignment:
Q |
156 |
cggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagct |
216 |
Q |
|
|
||||||| ||||||||||| || ||||||||||||| ||| ||||||||||| ||||||| |
|
|
T |
5579756 |
cggggtttgaaccccagaccttgcatatattatgcactgtccctaccaactgagctaagct |
5579696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 165 - 225
Target Start/End: Complemental strand, 20205876 - 20205816
Alignment:
Q |
165 |
aaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
|||||| |||||||||||||||||||||||| |||||||||| |||| |||| |||||| |
|
|
T |
20205876 |
aaccccggactttacatatattatgcattgtccataccaactgagctaaacttacgaggac |
20205816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 157 - 225
Target Start/End: Complemental strand, 24839550 - 24839482
Alignment:
Q |
157 |
ggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
|||| ||||||||||||| |||||||| ||||||||||| | |||||||||| |||||| | |||||| |
|
|
T |
24839550 |
ggggatcgaaccccagaccttacatattttatgcattgtctataccaactgagttaagctcacgaggac |
24839482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 156 - 208
Target Start/End: Complemental strand, 25251573 - 25251521
Alignment:
Q |
156 |
cggggttcgaaccccagactttacatatattatgcattgtttctaccaactga |
208 |
Q |
|
|
||||||| |||||||| || ||| |||||||||||||||||| |||||||||| |
|
|
T |
25251573 |
cggggtttgaaccccaaaccttatatatattatgcattgtttataccaactga |
25251521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 156 - 204
Target Start/End: Original strand, 46849105 - 46849153
Alignment:
Q |
156 |
cggggttcgaaccccagactttacatatattatgcattgtttctaccaa |
204 |
Q |
|
|
||||||| |||| ||| ||||||||||||||||||||||| |||||||| |
|
|
T |
46849105 |
cggggtttgaactccaaactttacatatattatgcattgtctctaccaa |
46849153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 150 - 225
Target Start/End: Original strand, 1120023 - 1120098
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
|||||| ||||||||||| ||| ||||||||||||||||| ||||| ||||||||| ||||||| | |||||| |
|
|
T |
1120023 |
ggtgtctggggttcgaacaccaaactttacatatattatgtattgtcctcaccaactgagctaagctcacgaggac |
1120098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 150 - 216
Target Start/End: Complemental strand, 17816590 - 17816523
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatata-ttatgcattgtttctaccaactgaactaagct |
216 |
Q |
|
|
||||||| ||||||||||||| |||||| |||||| ||||||||||| |||| |||||| ||||||| |
|
|
T |
17816590 |
ggtgtccagggttcgaaccccggactttgcatatatttatgcattgtctctatcaactgggctaagct |
17816523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 150 - 193
Target Start/End: Complemental strand, 26009345 - 26009302
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcatt |
193 |
Q |
|
|
||||||||| ||||||||||||||| || ||||||||||||||| |
|
|
T |
26009345 |
ggtgtccggagttcgaaccccagaccttgcatatattatgcatt |
26009302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 155 - 214
Target Start/End: Original strand, 43579050 - 43579109
Alignment:
Q |
155 |
ccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaag |
214 |
Q |
|
|
||||||||||||||| |||||| ||| ||||||||||||| ||||||||||| ||||| |
|
|
T |
43579050 |
ccggggttcgaacccaggactttgcatgtattatgcattgtccctaccaactgagctaag |
43579109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 156 - 207
Target Start/End: Complemental strand, 46732130 - 46732079
Alignment:
Q |
156 |
cggggttcgaaccccagactttacatatattatgcattgtttctaccaactg |
207 |
Q |
|
|
||||||| ||||| || |||||||||||||||| ||||||||||| |||||| |
|
|
T |
46732130 |
cggggttagaaccacatactttacatatattatacattgtttctatcaactg |
46732079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 150 - 216
Target Start/End: Original strand, 47155096 - 47155165
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgt---ttctaccaactgaactaagct |
216 |
Q |
|
|
|||||||||||||||||||| ||| || ||||||||||||||||| | ||||||||||| ||||||| |
|
|
T |
47155096 |
ggtgtccggggttcgaaccctggaccttgcatatattatgcattgtccctactaccaactgagctaagct |
47155165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 150 - 193
Target Start/End: Complemental strand, 48837936 - 48837893
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcatt |
193 |
Q |
|
|
|||| ||||||||||||||||| ||||| ||||||||||||||| |
|
|
T |
48837936 |
ggtggccggggttcgaaccccaaactttgcatatattatgcatt |
48837893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 156 - 218
Target Start/End: Complemental strand, 7908656 - 7908594
Alignment:
Q |
156 |
cggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagctta |
218 |
Q |
|
|
||||||||||||||| || |||||||| ||||||||||| ||||||||||||||| |||| |
|
|
T |
7908656 |
cggggttcgaaccccgaaccttacatattttatgcattgtccataccaactgaactaaactta |
7908594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 150 - 208
Target Start/End: Original strand, 8261435 - 8261493
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactga |
208 |
Q |
|
|
|||| ||||| ||||||||||| || |||||||| ||||||||||| | |||||||||| |
|
|
T |
8261435 |
ggtggccgggattcgaaccccaaaccttacatattttatgcattgtctataccaactga |
8261493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 150 - 216
Target Start/End: Complemental strand, 18714517 - 18714451
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagct |
216 |
Q |
|
|
||||| ||||||| ||||||| ||| || ||||||||||||||||| |||||||||| ||||||| |
|
|
T |
18714517 |
ggtgtacggggtttgaaccccggaccttgcatatattatgcattgtccttaccaactgagctaagct |
18714451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 157 - 195
Target Start/End: Complemental strand, 19793583 - 19793545
Alignment:
Q |
157 |
ggggttcgaaccccagactttacatatattatgcattgt |
195 |
Q |
|
|
|||||||||||||||||| ||||||||||||| |||||| |
|
|
T |
19793583 |
ggggttcgaaccccagaccttacatatattatacattgt |
19793545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 160 - 206
Target Start/End: Complemental strand, 21551792 - 21551746
Alignment:
Q |
160 |
gttcgaaccccagactttacatatattatgcattgtttctaccaact |
206 |
Q |
|
|
|||||||||| ||||||||||| |||||| |||||| |||||||||| |
|
|
T |
21551792 |
gttcgaaccctagactttacatttattatacattgtctctaccaact |
21551746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 150 - 208
Target Start/End: Original strand, 31292761 - 31292819
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactga |
208 |
Q |
|
|
|||| |||| ||||||||||||||| || ||| |||||||||||||| |||||||||| |
|
|
T |
31292761 |
ggtggccggagttcgaaccccagaccttgcatgtattatgcattgttcataccaactga |
31292819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 162 - 216
Target Start/End: Complemental strand, 37864482 - 37864428
Alignment:
Q |
162 |
tcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagct |
216 |
Q |
|
|
||||||||||||| || ||||||||||||||||| |||||||||| ||||||| |
|
|
T |
37864482 |
tcgaaccccagaccttgcatatattatgcattgtacttaccaactgagctaagct |
37864428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 154 - 216
Target Start/End: Original strand, 38858168 - 38858230
Alignment:
Q |
154 |
tccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagct |
216 |
Q |
|
|
|||||| |||||||| | ||| |||||||||||||||| ||| | |||||| ||||||||||| |
|
|
T |
38858168 |
tccgggattcgaacctcggaccttacatatattatgcactgtctttaccaattgaactaagct |
38858230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 156 - 193
Target Start/End: Complemental strand, 1046619 - 1046582
Alignment:
Q |
156 |
cggggttcgaaccccagactttacatatattatgcatt |
193 |
Q |
|
|
|||| |||||||||||||| |||||||||||||||||| |
|
|
T |
1046619 |
cgggattcgaaccccagaccttacatatattatgcatt |
1046582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 172 - 213
Target Start/End: Complemental strand, 1261222 - 1261181
Alignment:
Q |
172 |
gactttacatatattatgcattgtttctaccaactgaactaa |
213 |
Q |
|
|
||||||||||||||||||| |||||| || |||||||||||| |
|
|
T |
1261222 |
gactttacatatattatgctttgtttatatcaactgaactaa |
1261181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 164 - 221
Target Start/End: Original strand, 5435567 - 5435624
Alignment:
Q |
164 |
gaaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatga |
221 |
Q |
|
|
|||||||||| |||||||||||| ||||||||||||| |||| || |||||| |||| |
|
|
T |
5435567 |
gaaccccagatcttacatatattacgcattgtttctactaactaaagtaagctcatga |
5435624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 158 - 195
Target Start/End: Complemental strand, 6384912 - 6384875
Alignment:
Q |
158 |
gggttcgaaccccagactttacatatattatgcattgt |
195 |
Q |
|
|
||||||||||||||||| || ||||||||||||||||| |
|
|
T |
6384912 |
gggttcgaaccccagaccttgcatatattatgcattgt |
6384875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 159 - 216
Target Start/End: Original strand, 21050223 - 21050280
Alignment:
Q |
159 |
ggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagct |
216 |
Q |
|
|
|||||||| ||||||| || ||||||||||||||||| |||||||||| ||||||| |
|
|
T |
21050223 |
ggttcgaaacccagaccttgcatatattatgcattgtccttaccaactgagctaagct |
21050280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 151 - 208
Target Start/End: Original strand, 29237550 - 29237607
Alignment:
Q |
151 |
gtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactga |
208 |
Q |
|
|
||||||| ||||||||||| ||| || |||||||||||||||||| |||||||||| |
|
|
T |
29237550 |
gtgtccgaggttcgaaccctggaccttgcatatattatgcattgttcttaccaactga |
29237607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 151 - 188
Target Start/End: Original strand, 29698170 - 29698207
Alignment:
Q |
151 |
gtgtccggggttcgaaccccagactttacatatattat |
188 |
Q |
|
|
|||| ||||||||||||| ||||||||||||||||||| |
|
|
T |
29698170 |
gtgttcggggttcgaacctcagactttacatatattat |
29698207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 176 - 213
Target Start/End: Original strand, 31885963 - 31886000
Alignment:
Q |
176 |
ttacatatattatgcattgtttctaccaactgaactaa |
213 |
Q |
|
|
||||||||||||||||||||| ||||||||||||||| |
|
|
T |
31885963 |
ttacatatattatgcattgttcataccaactgaactaa |
31886000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 156 - 225
Target Start/End: Original strand, 35142147 - 35142216
Alignment:
Q |
156 |
cggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
||||||||||||| || ||||| ||||||||||||||||| || ||||||| ||||||| | |||||| |
|
|
T |
35142147 |
cggggttcgaacctcaaactttgcatatattatgcattgtccatatcaactgagctaagctcacgaggac |
35142216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 180 - 225
Target Start/End: Complemental strand, 36803877 - 36803832
Alignment:
Q |
180 |
atatattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
|||||||||||||||| |||||||||||| ||||||| | |||||| |
|
|
T |
36803877 |
atatattatgcattgtctctaccaactgagctaagctcacgaggac |
36803832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 156 - 209
Target Start/End: Complemental strand, 45151440 - 45151387
Alignment:
Q |
156 |
cggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaa |
209 |
Q |
|
|
||||||| |||||||| || |||||||||||||||||| || ||| |||||||| |
|
|
T |
45151440 |
cggggtttgaaccccaaaccttacatatattatgcattattcctatcaactgaa |
45151387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 156 - 217
Target Start/End: Original strand, 48629063 - 48629124
Alignment:
Q |
156 |
cggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagctt |
217 |
Q |
|
|
||||||| |||||| ||| || ||||||||||||||||| ||| |||||||||||||||| |
|
|
T |
48629063 |
cggggtttaaaccccggaccttgcatatattatgcattgtccctaacaactgaactaagctt |
48629124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 156 - 208
Target Start/End: Original strand, 7994882 - 7994934
Alignment:
Q |
156 |
cggggttcgaaccccagactttacatatattatgcattgtttctaccaactga |
208 |
Q |
|
|
||||||| ||||||||||| |||||||||||||| |||| ||||||||||| |
|
|
T |
7994882 |
cggggtttgaaccccagaccttacatatattatgttttgtccctaccaactga |
7994934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 156 - 208
Target Start/End: Complemental strand, 8318904 - 8318852
Alignment:
Q |
156 |
cggggttcgaaccccagactttacatatattatgcattgtttctaccaactga |
208 |
Q |
|
|
||||||| |||| || |||| ||||||| |||||||||||||||| ||||||| |
|
|
T |
8318904 |
cggggtttgaactccggactatacatatgttatgcattgtttctatcaactga |
8318852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 151 - 195
Target Start/End: Original strand, 8903635 - 8903679
Alignment:
Q |
151 |
gtgtccggggttcgaaccccagactttacatatattatgcattgt |
195 |
Q |
|
|
||||||| ||||||||||| |||| |||||||||| ||||||||| |
|
|
T |
8903635 |
gtgtccgaggttcgaacccaagacattacatatatcatgcattgt |
8903679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 158 - 230
Target Start/End: Complemental strand, 10244788 - 10244716
Alignment:
Q |
158 |
gggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgaggacgaaag |
230 |
Q |
|
|
||||| ||||||| ||| || ||||||||||||||||| |||||||||| ||||||| | |||||| |||| |
|
|
T |
10244788 |
gggtttgaaccccggaccttgcatatattatgcattgtccataccaactgagctaagctcacgaggactaaag |
10244716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 156 - 208
Target Start/End: Original strand, 10954911 - 10954963
Alignment:
Q |
156 |
cggggttcgaaccccagactttacatatattatgcattgtttctaccaactga |
208 |
Q |
|
|
|||||||| |||||||||| ||||||||||||| ||| ||| |||||||||| |
|
|
T |
10954911 |
cggggttcaaaccccagaccttacatatattatatattatttttaccaactga |
10954963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 150 - 225
Target Start/End: Complemental strand, 20243325 - 20243249
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatat-attatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
|||||||||||||| |||||| ||| || ||||| |||||||||||| |||||||||| ||||||| | |||||| |
|
|
T |
20243325 |
ggtgtccggggttcaaaccccggaccttgcatattattatgcattgtccataccaactgagctaagctcacgaggac |
20243249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 176 - 208
Target Start/End: Complemental strand, 22267624 - 22267592
Alignment:
Q |
176 |
ttacatatattatgcattgtttctaccaactga |
208 |
Q |
|
|
|||||||||||||||||||| |||||||||||| |
|
|
T |
22267624 |
ttacatatattatgcattgtctctaccaactga |
22267592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 156 - 208
Target Start/End: Original strand, 23198747 - 23198799
Alignment:
Q |
156 |
cggggttcgaaccccagactttacatatattatgcattgtttctaccaactga |
208 |
Q |
|
|
||||||| ||||||| |||||| ||||| |||||||||||| |||||||||| |
|
|
T |
23198747 |
cggggtttgaaccccggactttgcatattttatgcattgttcataccaactga |
23198799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 176 - 208
Target Start/End: Complemental strand, 23221435 - 23221403
Alignment:
Q |
176 |
ttacatatattatgcattgtttctaccaactga |
208 |
Q |
|
|
|||||||||||||||||||| |||||||||||| |
|
|
T |
23221435 |
ttacatatattatgcattgtctctaccaactga |
23221403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 150 - 218
Target Start/End: Complemental strand, 26471285 - 26471217
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagctta |
218 |
Q |
|
|
|||| |||| ||||| ||| |||||||||||||| ||||| ||||| |||||||||| ||||||||| |
|
|
T |
26471285 |
ggtggccggagttcggacctcagactttacatattttatgtattgtccataccaactgagctaagctta |
26471217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 150 - 218
Target Start/End: Complemental strand, 26547725 - 26547657
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagctta |
218 |
Q |
|
|
|||| |||| ||||| ||| |||||||||||||| ||||| ||||| |||||||||| ||||||||| |
|
|
T |
26547725 |
ggtggccggagttcggacctcagactttacatattttatgtattgtccataccaactgagctaagctta |
26547657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 151 - 216
Target Start/End: Complemental strand, 30296403 - 30296336
Alignment:
Q |
151 |
gtgtccggggttc--gaaccccagactttacatatattatgcattgtttctaccaactgaactaagct |
216 |
Q |
|
|
||||||||||||| ||||||||||| || |||||||||| |||||| |||||||||| ||||||| |
|
|
T |
30296403 |
gtgtccggggttcttgaaccccagaccttgcatatattatacattgtccttaccaactgagctaagct |
30296336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 38; Significance: 0.000000000002; HSPs: 64)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 150 - 215
Target Start/End: Original strand, 35191809 - 35191874
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagc |
215 |
Q |
|
|
|||||| |||||||||||||||||| || ||||||||||||||||| |||||||||| |||||| |
|
|
T |
35191809 |
ggtgtctggggttcgaaccccagaccttgcatatattatgcattgtccttaccaactgagctaagc |
35191874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 152 - 196
Target Start/End: Original strand, 14160272 - 14160316
Alignment:
Q |
152 |
tgtccggggttcgaaccccagactttacatatattatgcattgtt |
196 |
Q |
|
|
||||||||||||||||||| |||||| |||||||||||||||||| |
|
|
T |
14160272 |
tgtccggggttcgaaccccggactttgcatatattatgcattgtt |
14160316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 150 - 225
Target Start/End: Original strand, 1149061 - 1149136
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
||||||| |||||||||||| |||| || ||||||||||||||||| |||||||||| ||||||| | |||||| |
|
|
T |
1149061 |
ggtgtccagggttcgaaccctagaccttgcatatattatgcattgtccttaccaactgagctaagctcacgaggac |
1149136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 161 - 216
Target Start/End: Complemental strand, 7938782 - 7938727
Alignment:
Q |
161 |
ttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagct |
216 |
Q |
|
|
|||||||||||||| || ||||||||||||||||| |||||||||||||||||| |
|
|
T |
7938782 |
ttcgaaccccagaccttgtatatattatgcattgttcataccaactgaactaagct |
7938727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 156 - 223
Target Start/End: Complemental strand, 52576010 - 52575943
Alignment:
Q |
156 |
cggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgagg |
223 |
Q |
|
|
|||| |||||||||||||| || ||||| |||||||||||| |||||||||| ||||||||| |||| |
|
|
T |
52576010 |
cgggattcgaaccccagaccttgcatattttatgcattgttcataccaactgagctaagcttacgagg |
52575943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 179 - 221
Target Start/End: Original strand, 7232205 - 7232247
Alignment:
Q |
179 |
catatattatgcattgtttctaccaactgaactaagcttatga |
221 |
Q |
|
|
|||||||||||||||||||||||||||||| ||||||| |||| |
|
|
T |
7232205 |
catatattatgcattgtttctaccaactgacctaagctcatga |
7232247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 157 - 211
Target Start/End: Complemental strand, 31463546 - 31463492
Alignment:
Q |
157 |
ggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaact |
211 |
Q |
|
|
|||||| ||||| ||||| |||||||||||||||||| |||||| |||||||||| |
|
|
T |
31463546 |
ggggtttgaacctcagaccttacatatattatgcattatttctatcaactgaact |
31463492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 179 - 225
Target Start/End: Complemental strand, 33223908 - 33223862
Alignment:
Q |
179 |
catatattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
|||||||||||||||||||||||||||||| ||||||| | |||||| |
|
|
T |
33223908 |
catatattatgcattgtttctaccaactgagctaagctcacgaggac |
33223862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 150 - 208
Target Start/End: Complemental strand, 41151531 - 41151473
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactga |
208 |
Q |
|
|
||||||||| |||||||||||||| || |||||||||||| ||| ||| |||||||||| |
|
|
T |
41151531 |
ggtgtccggagttcgaaccccagatttaacatatattatgtattatttttaccaactga |
41151473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 155 - 225
Target Start/End: Complemental strand, 48376899 - 48376829
Alignment:
Q |
155 |
ccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
||||| ||||||||||| || |||||||||||||||||| | | |||||||||| ||||||| | |||||| |
|
|
T |
48376899 |
ccgggattcgaaccccaaaccttacatatattatgcattatctttaccaactgagctaagctcacgaggac |
48376829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 164 - 206
Target Start/End: Original strand, 52543698 - 52543740
Alignment:
Q |
164 |
gaaccccagactttacatatattatgcattgtttctaccaact |
206 |
Q |
|
|
|||||||| |||||||||||||||||||||||| ||||||||| |
|
|
T |
52543698 |
gaaccccacactttacatatattatgcattgttcctaccaact |
52543740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 150 - 216
Target Start/End: Complemental strand, 53996368 - 53996302
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagct |
216 |
Q |
|
|
|||| ||||| |||||||||||||| || ||||||||||||||||| |||||||||| ||||||| |
|
|
T |
53996368 |
ggtggccgggattcgaaccccagaccttgcatatattatgcattgtccataccaactgagctaagct |
53996302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 151 - 213
Target Start/End: Original strand, 54230092 - 54230154
Alignment:
Q |
151 |
gtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaa |
213 |
Q |
|
|
||||||||||||||||||||| || || ||||||||||||||||| |||||||||| |||| |
|
|
T |
54230092 |
gtgtccggggttcgaaccccaaaccttgcatatattatgcattgtccttaccaactgagctaa |
54230154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 156 - 225
Target Start/End: Original strand, 7464489 - 7464558
Alignment:
Q |
156 |
cggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
||||||| ||||||| ||| |||||||||||||||||||| ||||||||||| |||||| | |||||| |
|
|
T |
7464489 |
cggggtttgaaccccggaccttacatatattatgcattgtccctaccaactgagttaagctcacgaggac |
7464558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 155 - 208
Target Start/End: Original strand, 19939038 - 19939091
Alignment:
Q |
155 |
ccggggttcgaaccccagactttacatatattatgcattgtttctaccaactga |
208 |
Q |
|
|
|||| ||||||||||||||| || |||||||||||||||||| |||||||||| |
|
|
T |
19939038 |
ccggcgttcgaaccccagacctttcatatattatgcattgttcttaccaactga |
19939091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 156 - 225
Target Start/End: Complemental strand, 32632384 - 32632315
Alignment:
Q |
156 |
cggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
||||||| |||| ||| | ||||||||||||||||||||||| |||||||||| | ||||| | |||||| |
|
|
T |
32632384 |
cggggtttgaactccaaattttacatatattatgcattgtttataccaactgagcaaagctcacgaggac |
32632315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 161 - 225
Target Start/End: Original strand, 1757672 - 1757736
Alignment:
Q |
161 |
ttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
|||||| ||||||| || |||||||||||||||||| ||||||||||| |||||| | |||||| |
|
|
T |
1757672 |
ttcgaatcccagacgttgcatatattatgcattgttcctaccaactgagttaagctcacgaggac |
1757736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 173 - 213
Target Start/End: Complemental strand, 12408224 - 12408184
Alignment:
Q |
173 |
actttacatatattatgcattgtttctaccaactgaactaa |
213 |
Q |
|
|
||||||||||||||||||||||| |||||||||||||||| |
|
|
T |
12408224 |
actttacatatattatgcattgtccctaccaactgaactaa |
12408184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 150 - 214
Target Start/End: Original strand, 25441492 - 25441556
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaag |
214 |
Q |
|
|
|||| |||||||| ||||||||||| || ||||||||||||||||| |||||||||| ||||| |
|
|
T |
25441492 |
ggtggccggggtttgaaccccagaccttgcatatattatgcattgtccataccaactgagctaag |
25441556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 150 - 216
Target Start/End: Complemental strand, 5239864 - 5239797
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatata-ttatgcattgtttctaccaactgaactaagct |
216 |
Q |
|
|
||||||| ||||||||||||| |||||| |||||| ||||||||||| |||| |||||| ||||||| |
|
|
T |
5239864 |
ggtgtccagggttcgaaccccggactttgcatatatttatgcattgtctctatcaactgggctaagct |
5239797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 150 - 225
Target Start/End: Complemental strand, 8075854 - 8075779
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
|||| |||||||| ||||| ||||| || ||||||||||||||||| |||| |||||| |||||||| |||||| |
|
|
T |
8075854 |
ggtggccggggtttgaacctcagaccttgcatatattatgcattgtctctattaactgaggtaagcttacgaggac |
8075779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 157 - 208
Target Start/End: Original strand, 26610492 - 26610542
Alignment:
Q |
157 |
ggggttcgaaccccagactttacatatattatgcattgtttctaccaactga |
208 |
Q |
|
|
||||||||||||||| || ||||||||||||||||||| | ||||||||||| |
|
|
T |
26610492 |
ggggttcgaaccccataccttacatatattatgcattg-tcctaccaactga |
26610542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 150 - 225
Target Start/End: Original strand, 28130926 - 28131001
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
|||||||||| ||| |||||||||| || ||||||||||||||||| ||||| ||||||||||| | |||||| |
|
|
T |
28130926 |
ggtgtccgggattcaaaccccagaccttgcatatattatgcattgtccttaccatttgaactaagctcacgaggac |
28131001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 150 - 225
Target Start/End: Original strand, 35863805 - 35863880
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
|||| ||| |||| ||||||||||| || ||||||||||| ||||| |||||||||| ||||||||| |||||| |
|
|
T |
35863805 |
ggtggccgaggtttgaaccccagaccttgcatatattatgtattgtccttaccaactgagctaagcttacgaggac |
35863880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 179 - 225
Target Start/End: Complemental strand, 2662132 - 2662086
Alignment:
Q |
179 |
catatattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
||||||||||||||||| | |||||||||| |||| ||||||||||| |
|
|
T |
2662132 |
catatattatgcattgtctttaccaactgagctaaacttatgaggac |
2662086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 168 - 218
Target Start/End: Original strand, 3176983 - 3177033
Alignment:
Q |
168 |
cccagactttacatatattatgcattgtttctaccaactgaactaagctta |
218 |
Q |
|
|
||||||| || |||||||||||||||||| ||||||||||| |||||||| |
|
|
T |
3176983 |
cccagaccttgcatatattatgcattgttcctaccaactgagttaagctta |
3177033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 156 - 213
Target Start/End: Complemental strand, 5030269 - 5030211
Alignment:
Q |
156 |
cggggttcgaaccccagactttacatat-attatgcattgtttctaccaactgaactaa |
213 |
Q |
|
|
|||||||||||| | ||| ||||||||| ||||||||||||| ||||||||||||||| |
|
|
T |
5030269 |
cggggttcgaactcaagattttacatattattatgcattgttcataccaactgaactaa |
5030211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 150 - 216
Target Start/End: Complemental strand, 13800736 - 13800670
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagct |
216 |
Q |
|
|
|||||||||||||||||| ||| || |||||||||||||||||| |||||||||| ||||||| |
|
|
T |
13800736 |
ggtgtccggggttcgaactgtggaccttgcatatattatgcattgttcttaccaactgagctaagct |
13800670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 157 - 195
Target Start/End: Original strand, 13829076 - 13829114
Alignment:
Q |
157 |
ggggttcgaaccccagactttacatatattatgcattgt |
195 |
Q |
|
|
|||||||||||||||||| || ||||||||||||||||| |
|
|
T |
13829076 |
ggggttcgaaccccagaccttgcatatattatgcattgt |
13829114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 157 - 223
Target Start/End: Complemental strand, 20400139 - 20400073
Alignment:
Q |
157 |
ggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgagg |
223 |
Q |
|
|
|||||| ||||| ||||| || ||||||||||| ||||| ||| ||||||| |||||||||||||| |
|
|
T |
20400139 |
ggggtttgaacctcagaccttgcatatattatgtattgtctctgtcaactgagctaagcttatgagg |
20400073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 155 - 225
Target Start/End: Original strand, 21506755 - 21506825
Alignment:
Q |
155 |
ccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
||||||||| |||||||||| || ||||| ||||||||||| |||||||||| ||||||| | |||||| |
|
|
T |
21506755 |
ccggggttcaaaccccagaccttgcatattttatgcattgtccataccaactgagctaagctcacgaggac |
21506825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 150 - 216
Target Start/End: Complemental strand, 30200895 - 30200829
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagct |
216 |
Q |
|
|
||||||||||||||||||| || || || ||||||||||||||||| || ||||||| ||||||| |
|
|
T |
30200895 |
ggtgtccggggttcgaacctcaaaccttgcatatattatgcattgtccttagcaactgagctaagct |
30200829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 176 - 214
Target Start/End: Complemental strand, 31214677 - 31214639
Alignment:
Q |
176 |
ttacatatattatgcattgtttctaccaactgaactaag |
214 |
Q |
|
|
|||||||||||||||||| |||||||||||| ||||||| |
|
|
T |
31214677 |
ttacatatattatgcattatttctaccaacttaactaag |
31214639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 155 - 225
Target Start/End: Complemental strand, 44579700 - 44579630
Alignment:
Q |
155 |
ccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
|||||||||||||||| ||| || ||||| ||||||||||| |||||||||| ||||||| | |||||| |
|
|
T |
44579700 |
ccggggttcgaaccccggaccttgcatattttatgcattgtccataccaactgagctaagctcacgaggac |
44579630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 158 - 216
Target Start/End: Complemental strand, 45432009 - 45431951
Alignment:
Q |
158 |
gggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagct |
216 |
Q |
|
|
||||| ||||||| ||| || ||||||||||||||||| ||||||||||| ||||||| |
|
|
T |
45432009 |
gggtttgaaccccggaccttgcatatattatgcattgtccctaccaactgagctaagct |
45431951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 170 - 224
Target Start/End: Original strand, 47496998 - 47497052
Alignment:
Q |
170 |
cagactttacatatattatgcattgtttctaccaactgaactaagcttatgagga |
224 |
Q |
|
|
||||||||||||||||||| |||| ||| |||||||| || |||| ||||||||| |
|
|
T |
47496998 |
cagactttacatatattatacattatttttaccaactaaattaagtttatgagga |
47497052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 150 - 216
Target Start/End: Complemental strand, 52119445 - 52119379
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagct |
216 |
Q |
|
|
|||| |||||||||||||||| || || ||||||||||||||||| |||||||||| ||||||| |
|
|
T |
52119445 |
ggtggccggggttcgaaccccgaaccttgcatatattatgcattgtccttaccaactgagctaagct |
52119379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 158 - 216
Target Start/End: Complemental strand, 53208031 - 53207973
Alignment:
Q |
158 |
gggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagct |
216 |
Q |
|
|
||||||||||||||||| || |||||||||||||||| |||||||||| ||||||| |
|
|
T |
53208031 |
gggttcgaaccccagaccttgcatatattatgcattgcccttaccaactgagctaagct |
53207973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 175 - 225
Target Start/End: Complemental strand, 53852779 - 53852729
Alignment:
Q |
175 |
tttacatatattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
||||||||||||||||||||||| | |||||||| |||| |||| |||||| |
|
|
T |
53852779 |
tttacatatattatgcattgtttatgccaactgagctaaacttacgaggac |
53852729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 173 - 214
Target Start/End: Original strand, 759609 - 759650
Alignment:
Q |
173 |
actttacatatattatgcattgtttctaccaactgaactaag |
214 |
Q |
|
|
||||| ||||||||||||||||| ||||||||||||||||| |
|
|
T |
759609 |
actttgcatatattatgcattgtccctaccaactgaactaag |
759650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 173 - 226
Target Start/End: Complemental strand, 7868768 - 7868715
Alignment:
Q |
173 |
actttacatatattatgcattgtttctaccaactgaactaagcttatgaggacg |
226 |
Q |
|
|
||||| |||||||||||||||||| |||||||||| ||||||| | ||||||| |
|
|
T |
7868768 |
actttgcatatattatgcattgttcttaccaactgagctaagctcacgaggacg |
7868715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 150 - 195
Target Start/End: Original strand, 14149538 - 14149583
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgt |
195 |
Q |
|
|
||||||||||||||||||||||||| || |||| ||||| |||||| |
|
|
T |
14149538 |
ggtgtccggggttcgaaccccagaccttgcatacattatacattgt |
14149583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 152 - 193
Target Start/End: Original strand, 15507265 - 15507306
Alignment:
Q |
152 |
tgtccggggttcgaaccccagactttacatatattatgcatt |
193 |
Q |
|
|
|||||||| |||||||| ||||| |||||||||||||||||| |
|
|
T |
15507265 |
tgtccgggattcgaacctcagaccttacatatattatgcatt |
15507306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 159 - 216
Target Start/End: Complemental strand, 21245853 - 21245796
Alignment:
Q |
159 |
ggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagct |
216 |
Q |
|
|
|||| ||||||||||| |||||||||||||||||||| |||||||| | ||||||| |
|
|
T |
21245853 |
ggtttgaaccccagaccttacatatattatgcattgtccttaccaactaagctaagct |
21245796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 158 - 195
Target Start/End: Original strand, 25505701 - 25505738
Alignment:
Q |
158 |
gggttcgaaccccagactttacatatattatgcattgt |
195 |
Q |
|
|
||||||||||||||||| || ||||||||||||||||| |
|
|
T |
25505701 |
gggttcgaaccccagaccttgcatatattatgcattgt |
25505738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 150 - 195
Target Start/End: Complemental strand, 27143115 - 27143070
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgt |
195 |
Q |
|
|
|||||||||| ||||||||| |||| ||||||||||||| |||||| |
|
|
T |
27143115 |
ggtgtccgggattcgaaccctagaccttacatatattatacattgt |
27143070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 159 - 216
Target Start/End: Complemental strand, 27185537 - 27185480
Alignment:
Q |
159 |
ggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagct |
216 |
Q |
|
|
|||| ||||||||||| || ||||||||||| ||||| ||||||||||| ||||||| |
|
|
T |
27185537 |
ggtttgaaccccagaccttgcatatattatgtattgtccctaccaactgagctaagct |
27185480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 156 - 225
Target Start/End: Original strand, 28244102 - 28244171
Alignment:
Q |
156 |
cggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
||||||||||||||| ||| || ||||| |||||||||||| |||||||||| |||||| | |||||| |
|
|
T |
28244102 |
cggggttcgaaccccggaccttgcatattttatgcattgttcataccaactgagttaagctcacgaggac |
28244171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 150 - 195
Target Start/End: Complemental strand, 41087640 - 41087595
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgt |
195 |
Q |
|
|
||||| |||| ||||||| |||||||||||||||||||||||||| |
|
|
T |
41087640 |
ggtgttcgggcttcgaacttcagactttacatatattatgcattgt |
41087595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 150 - 195
Target Start/End: Complemental strand, 45096095 - 45096050
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgt |
195 |
Q |
|
|
|||||| |||||||||||| ||||| || ||||||||||||||||| |
|
|
T |
45096095 |
ggtgtctggggttcgaaccacagaccttgcatatattatgcattgt |
45096050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 176 - 225
Target Start/End: Original strand, 47040912 - 47040961
Alignment:
Q |
176 |
ttacatatattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
||||||| ||||||||||||| || ||||||||||||||||| |||||| |
|
|
T |
47040912 |
ttacatacattatgcattgttcatatcaactgaactaagcttacgaggac |
47040961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 155 - 208
Target Start/End: Complemental strand, 52089380 - 52089327
Alignment:
Q |
155 |
ccggggttcgaaccccagactttacatatattatgcattgtttctaccaactga |
208 |
Q |
|
|
||||||||||||||||| || || |||||||||| ||||| |||||||||||| |
|
|
T |
52089380 |
ccggggttcgaaccccaaaccttgcatatattatatattgtctctaccaactga |
52089327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 159 - 204
Target Start/End: Complemental strand, 55494749 - 55494704
Alignment:
Q |
159 |
ggttcgaaccccagactttacatatattatgcattgtttctaccaa |
204 |
Q |
|
|
|||||||||||||| | |||||||||||||||||||| ||||||| |
|
|
T |
55494749 |
ggttcgaaccccagtccttacatatattatgcattgtccctaccaa |
55494704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 164 - 208
Target Start/End: Complemental strand, 2078295 - 2078251
Alignment:
Q |
164 |
gaaccccagactttacatatattatgcattgtttctaccaactga |
208 |
Q |
|
|
|||||||| || || ||||||||||||||||| |||||||||||| |
|
|
T |
2078295 |
gaaccccaaaccttgcatatattatgcattgtctctaccaactga |
2078251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 165 - 225
Target Start/End: Original strand, 2153508 - 2153568
Alignment:
Q |
165 |
aaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
|||||||||| || ||||||||||||||||| |||||||||| |||||||| |||||| |
|
|
T |
2153508 |
aaccccagaccttgcatatattatgcattgtccaaaccaactgaattaagcttaggaggac |
2153568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 156 - 208
Target Start/End: Original strand, 2186425 - 2186477
Alignment:
Q |
156 |
cggggttcgaaccccagactttacatatattatgcattgtttctaccaactga |
208 |
Q |
|
|
||||||| ||||||||||| |||||||||||||| ||||| |||||||||| |
|
|
T |
2186425 |
cggggtttgaaccccagaccttacatatattatgtattgtccataccaactga |
2186477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 156 - 208
Target Start/End: Original strand, 19139429 - 19139481
Alignment:
Q |
156 |
cggggttcgaaccccagactttacatatattatgcattgtttctaccaactga |
208 |
Q |
|
|
||||||| |||||| ||||||||||| |||||||||||| ||||||||||| |
|
|
T |
19139429 |
cggggtttgaaccctgaactttacatatgttatgcattgttcctaccaactga |
19139481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 157 - 225
Target Start/End: Original strand, 21914070 - 21914138
Alignment:
Q |
157 |
ggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgaggac |
225 |
Q |
|
|
||||||||||||||| || || ||||||||||||||||| |||||||||| |||||| ||| |||| |
|
|
T |
21914070 |
ggggttcgaaccccataccttgcatatattatgcattgtccttaccaactgagttaagctcatggggac |
21914138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 158 - 222
Target Start/End: Complemental strand, 28266777 - 28266713
Alignment:
Q |
158 |
gggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgag |
222 |
Q |
|
|
|||| |||||||| ||| || ||||||||||||||||| ||||||||||||||| || ||||| |
|
|
T |
28266777 |
gggtacgaaccccggaccttgcatatattatgcattgtccttaccaactgaactaacctcatgag |
28266713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 164 - 216
Target Start/End: Original strand, 28430571 - 28430623
Alignment:
Q |
164 |
gaaccccagactttacatatattatgcattgtttctaccaactgaactaagct |
216 |
Q |
|
|
||||| ||||| || |||||||||||||||||| ||||||||||| |||||| |
|
|
T |
28430571 |
gaacctcagaccttgcatatattatgcattgttcgtaccaactgaattaagct |
28430623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 150 - 226
Target Start/End: Original strand, 44447153 - 44447229
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagcttatgaggacg |
226 |
Q |
|
|
|||| ||||||||||||||||| | |||||| |||| ||||||||| |||||||| | ||||||| | ||||||| |
|
|
T |
44447153 |
ggtggccggggttcgaaccccatatcttacatgtattttgcattgttcataccaactaagctaagctcacgaggacg |
44447229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 161 - 217
Target Start/End: Complemental strand, 45254289 - 45254233
Alignment:
Q |
161 |
ttcgaaccccagactttacatatattatgcattgtttctaccaactgaactaagctt |
217 |
Q |
|
|
||||||| ||| || |||||||||||||||||||| |||||||||| |||||||| |
|
|
T |
45254289 |
ttcgaactccaaaccttacatatattatgcattgtccttaccaactgagctaagctt |
45254233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 164 - 208
Target Start/End: Original strand, 48022320 - 48022364
Alignment:
Q |
164 |
gaaccccagactttacatatattatgcattgtttctaccaactga |
208 |
Q |
|
|
||||||| ||||| ||||||||||||||||| |||||||||||| |
|
|
T |
48022320 |
gaaccccgaactttgcatatattatgcattgtctctaccaactga |
48022364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 176 - 216
Target Start/End: Original strand, 54020667 - 54020707
Alignment:
Q |
176 |
ttacatatattatgcattgtttctaccaactgaactaagct |
216 |
Q |
|
|
||||||||||||||||||||| ||||||||| | ||||||| |
|
|
T |
54020667 |
ttacatatattatgcattgttcctaccaactaagctaagct |
54020707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0426 (Bit Score: 32; Significance: 0.000000009; HSPs: 1)
Name: scaffold0426
Description:
Target: scaffold0426; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 150 - 193
Target Start/End: Original strand, 5832 - 5875
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcatt |
193 |
Q |
|
|
|||||| |||||||||||||||||| ||||||||||||| |||| |
|
|
T |
5832 |
ggtgtctggggttcgaaccccagaccttacatatattatacatt |
5875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 166 - 216
Target Start/End: Complemental strand, 349680 - 349630
Alignment:
Q |
166 |
accccagactttacatatattatgcattgtttctaccaactgaactaagct |
216 |
Q |
|
|
||||| ||||||| ||||||||| ||||||| ||||||| ||||||||||| |
|
|
T |
349680 |
accccggactttatatatattatacattgttcctaccaattgaactaagct |
349630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0354 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0354
Description:
Target: scaffold0354; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 150 - 195
Target Start/End: Original strand, 7212 - 7257
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgt |
195 |
Q |
|
|
||||||||||||||||||||||||| ||| ||||| ||||| |||| |
|
|
T |
7212 |
ggtgtccggggttcgaaccccagaccttatatataatatgcgttgt |
7257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0066 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0066
Description:
Target: scaffold0066; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 150 - 195
Target Start/End: Complemental strand, 17573 - 17528
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgt |
195 |
Q |
|
|
|||||||||| ||||||||||| || || ||||||||||||||||| |
|
|
T |
17573 |
ggtgtccgggattcgaaccccaaaccttgcatatattatgcattgt |
17528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0038 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0038
Description:
Target: scaffold0038; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 150 - 218
Target Start/End: Original strand, 31641 - 31710
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatata-ttatgcattgtttctaccaactgaactaagctta |
218 |
Q |
|
|
||||||||||||||||||||| ||||| ||||||| ||||| |||||| ||| || |||| |||| |||| |
|
|
T |
31641 |
ggtgtccggggttcgaaccccggacttgacatatatttatgaattgttcctatcatctgagctaaactta |
31710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1127 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: scaffold1127
Description:
Target: scaffold1127; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 157 - 205
Target Start/End: Original strand, 1164 - 1212
Alignment:
Q |
157 |
ggggttcgaaccccagactttacatatattatgcattgtttctaccaac |
205 |
Q |
|
|
|||||| ||||||| ||| || |||||||||||||||||| |||||||| |
|
|
T |
1164 |
ggggtttgaaccccggaccttgcatatattatgcattgttcctaccaac |
1212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0445 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: scaffold0445
Description:
Target: scaffold0445; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 150 - 206
Target Start/End: Complemental strand, 4539 - 4483
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatattatgcattgtttctaccaact |
206 |
Q |
|
|
|||||||||| ||||||| | |||| |||||||||||||||||| || ||| ||||| |
|
|
T |
4539 |
ggtgtccgggattcgaactctagaccttacatatattatgcattattcctatcaact |
4483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 150 - 186
Target Start/End: Complemental strand, 99383 - 99347
Alignment:
Q |
150 |
ggtgtccggggttcgaaccccagactttacatatatt |
186 |
Q |
|
|
||||||||||||||||||||| ||||| ||||||||| |
|
|
T |
99383 |
ggtgtccggggttcgaaccccggacttgacatatatt |
99347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3557 times since January 2019
Visitors: 4814